PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 02-MAR-2017

⊟Summary

• organism: Staphylococcus aureus N315
• locus tag: SA_RS12885 [old locus tag: SA2243 ]
• pan locus tag^?: SAUPAN006010000
• symbol: SA_RS12885
• pan gene symbol^?: —
• synonym:
• product: methionine ABC transporter ATP-binding protein

⊟Genome View

⊟Gene

⊟General

• type: CDS
• locus tag: SA_RS12885 [old locus tag: SA2243 ]
• symbol: SA_RS12885
• product: methionine ABC transporter ATP-binding protein
• replicon: chromosome
• strand: -
• coordinates: 2520153..2520815
• length: 663
• essential: no DEG other strains

⊟Accession numbers

• Location: NC_002745 (2520153..2520815) NCBI
• BioCyc: SA_RS12885 BioCyc
• MicrobesOnline: see SA2243

⊟Phenotype

Share your knowledge and add information here. [edit]

⊟DNA sequence

• 1
  61
  121
  181
  241
  301
  361
  421
  481
  541
  601
  661
  
  ATGTTGTTAGAAATTAAAGATTTAGTGTATAAAGCGAGCGATAGAATCATACTAGATCAT
  ATCAGTCTAAAAGTAGATAAAGGCGAGAGTATTGCCATTATAGGTCCATCAGGTAGTGGT
  AAAAGTACATTTCAAAAGCAAATATGTAATTTGATTAGTCCAACTAGTGGAGAACTTTAT
  TTTAAAGGTAAACCCTATAATGATTATGACCCGGAAGAATTGCGTCAACGAATCAGTTAT
  TTGATGCAGCAAAGTGACTTGTTTGGTGAAACGATTGAAGATAACATGATATTCCCATCA
  CTTGCACGTAATGATAAATTTGATAGAAAACGTGCAAAGCAATTAATTAAAGATGTCGGT
  TTGGGACATTATCAATTAAGTTCGGAAGTGGAAAATATGTCGGGTGGTGAGCGGCAAAGA
  ATTGCTATAGCGCGCCAACTGATGTATACACCGGATATTCTTTTATTAGATGAATCGACC
  AGTGCATTAGACGTTAATAATAAAGAAAAGATAGAAAATATCATTTTTAAGTTAGTGGAA
  CAGGATGTTGCTATCATGTGGATTACCCATAGTGATGATCAAAGTATGAGACATTTTCAA
  AAGCGCATAACGATTGTTGATGGCAAAATTTCTAAGGTTGAGGAGTTGAATCAACATGAG
  TAA
  60
  120
  180
  240
  300
  360
  420
  480
  540
  600
  660
  663
  

⊟Protein

⊟General

• locus tag: SA_RS12885 [old locus tag: SA2243 ]
• symbol: SA_RS12885
• description: methionine ABC transporter ATP-binding protein
• length: 220
• theoretical pI: 5.40235
• theoretical MW: 25250.7
• GRAVY: -0.474091

⊟Function

• TIGRFAM:
  Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 137.5)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 137.5)
  Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 136.8)
  Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 136.8)
  Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 133.9)
  Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 131.4)
  Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 129.8)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 128.7)
  thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 128.5)
  Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 125.9)
  thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 125.8)
  ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 123.4)
  Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 123.2)
  Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 123.2)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 121.9)
  Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 121.6)
  Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 121.6)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 119.5)
  Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 119.5)
  Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 119.5)
  Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 119.4)
  Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 119.4)
  Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 117.5)
  Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 116.6)
  Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 115)
  Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 114.2)
  Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 113.5)
  Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 112.1)
  and 48 more
  Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 109.6)
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 108)
  Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 107.6)
  Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 105.9)
  Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 105.9)
  ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 105.5)
  Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 104.3)
  2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 103.8)
  Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 103.5)
  Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 99.2)
  gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 95.9)
  Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 95.7)
  ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 94.5)
  Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 91.6)
  Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 91.6)
  lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 90.5)
  Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 89.9)
  D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 88.4)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 85.8)
  Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 85.8)
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 85.6)
  Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 84.6)
  Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 83.5)
  Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 83.2)
  proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 82.9)
  Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 77.7)
  phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 77.6)
  Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 77.5)
  ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 74.1)
  Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 74)
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 72)
  Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 70)
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 67.2)
  Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 63.1)
  Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 63.1)
  Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 61.5)
  Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 61.5)
  Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 58.8)
  Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 51.8)
  Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 47.8)
  Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 46.3)
  Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 45.6)
  Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 31.8)
  Metabolism Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 18.1)
  P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 15.6)
  Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions cytidylate kinase (TIGR00017; EC 2.7.4.14; HMM-score: 15.1)
  Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 14.3)
  Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 14.3)
• TheSEED: see SA2243
• PFAM:
  P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 114.2)
  and 28 more
  SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 28.5)
  AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 21.6)
  AAA_18; AAA domain (PF13238; HMM-score: 19.5)
  AAA_16; AAA ATPase domain (PF13191; HMM-score: 19.1)
  RNA_helicase; RNA helicase (PF00910; HMM-score: 16.8)
  IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 16.5)
  NACHT; NACHT domain (PF05729; HMM-score: 16.5)
  G-alpha; G-protein alpha subunit (PF00503; HMM-score: 16.4)
  AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 16.2)
  RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 15.6)
  AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 15.6)
  AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 15.5)
  AAA_24; AAA domain (PF13479; HMM-score: 15.3)
  AAA_22; AAA domain (PF13401; HMM-score: 15.2)
  DUF87; Domain of unknown function DUF87 (PF01935; HMM-score: 15.1)
  Cytidylate_kin; Cytidylate kinase (PF02224; HMM-score: 15)
  AAA_33; AAA domain (PF13671; HMM-score: 14.8)
  NTPase_1; NTPase (PF03266; HMM-score: 14.5)
  PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 14.4)
  SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 14.3)
  T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 13.9)
  MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 13.5)
  AAA_14; AAA domain (PF13173; HMM-score: 12.7)
  NB-ARC; NB-ARC domain (PF00931; HMM-score: 12.4)
  no clan defined DUF3987; Protein of unknown function (DUF3987) (PF13148; HMM-score: 12.2)
  P-loop_NTPase (CL0023) AAA_23; AAA domain (PF13476; HMM-score: 12.1)
  AAA_25; AAA domain (PF13481; HMM-score: 12)
  AAA_10; AAA-like domain (PF12846; HMM-score: 10.9)

⊟Structure, modifications & cofactors

• domains:
• modifications:
• cofactors:
• effectors:

⊟Localization

• PSORTb: Cytoplasmic Membrane
  • Cytoplasmic Score: 0.04
  • Cytoplasmic Membrane Score: 9.96
  • Cellwall Score: 0
  • Extracellular Score: 0
  • Internal Helices: 0
• LocateP:
• SignalP: no predicted signal peptide
  • SP(Sec/SPI): 0.012362
  • TAT(Tat/SPI): 0.000636
  • LIPO(Sec/SPII): 0.001616
• predicted transmembrane helices (TMHMM): 0

⊟Accession numbers

• GI: 446846270 NCBI
• RefSeq: WP_000923526 NCBI
• UniProt: see SA2243

⊟Protein sequence

• MLLEIKDLVYKASDRIILDHISLKVDKGESIAIIGPSGSGKSTFQKQICNLISPTSGELYFKGKPYNDYDPEELRQRISYLMQQSDLFGETIEDNMIFPSLARNDKFDRKRAKQLIKDVGLGHYQLSSEVENMSGGERQRIAIARQLMYTPDILLLDESTSALDVNNKEKIENIIFKLVEQDVAIMWITHSDDQSMRHFQKRITIVDGKISKVEELNQHE

⊟Experimental data

• experimentally validated: data available for COL, NCTC8325
• protein localization: data available for COL
• quantitative data / protein copy number per cell: data available for COL
• interaction partners:

⊟Expression & Regulation

⊟Operon

⊟Regulation

• data available for COL, NCTC8325, Newman

⊟Transcription pattern

• S.aureus Expression Data Browser: data available for NCTC8325

⊟Protein synthesis (provided by Aureolib)

• Aureolib: no data available

⊟Protein stability

• half-life: no data available

⊟Biological Material

⊟Mutants

⊟Expression vector

⊟lacZ fusion

⊟GFP fusion

⊟two-hybrid system

⊟FLAG-tag construct

⊟Antibody

⊟Other Information

You are kindly invited to share additional interesting facts.

⊟Literature

⊟References

⊟Relevant publications