From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_RS11120 [old locus tag: SAUSA300_2022 ]
  • pan locus tag?: SAUPAN005333000
  • symbol: SAUSA300_RS11120
  • pan gene symbol?: sigB
  • synonym:
  • product: RNA polymerase sigma factor SigB

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS11120 [old locus tag: SAUSA300_2022 ]
  • symbol: SAUSA300_RS11120
  • product: RNA polymerase sigma factor SigB
  • replicon: chromosome
  • strand: -
  • coordinates: 2184996..2185766
  • length: 771
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGGCGAAAGAGTCGAAATCAGCTAATGAAATTTCACCTGAGCAAATTAACCAATGGATT
    AAAGAACACCAAGAAAATAAGAATACAGATGCACAGGATAAGTTAGTTAAACATTACCAA
    AAACTAATTGAGTCATTGGCATATAAATATTCTAAAGGACAATCACATCACGAAGATTTA
    GTTCAAGTTGGTATGGTTGGTTTAATAGGTGCCATAAATAGATTCGATATGTCCTTTGAA
    CGGAAGTTTGAAGCCTTTTTAGTACCTACTGTAATCGGTGAAATCAAAAGATATCTACGA
    GATAAAACTTGGAGTGTACATGTTCCGAGACGTATTAAAGAAATTGGGCCAAGAATCAAA
    AAAGTGAGCGATGAACTAACCGCTGAATTAGAGCGTTCACCTTCTATCAGTGAAATAGCT
    GATCGATTAGAAGTCTCAGAAGAAGAAGTGTTAGAAGCAATGGAAATGGGACAAAGTTAT
    AATGCGTTAAGTGTTGATCATTCCATTGAAGCTGATAAAGATGGTTCAACTGTTACGCTA
    TTAGATATTATGGGGCAACAAGATGACCATTATGACTTAACTGAAAAACGTATGATTTTA
    GAAAAAATATTACCTATATTATCTGATCGCGAACGAGAAATCATACAATGTACGTTTATT
    GAAGGATTGAGTCAAAAAGAGACAGGTGAGCGTATCGGTTTAAGTCAAATGCATGTATCA
    CGACTTCAGAGAACGGCAATTAAGAAATTACAAGAAGCAGCACATCAATAG
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    771

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS11120 [old locus tag: SAUSA300_2022 ]
  • symbol: SAUSA300_RS11120
  • description: RNA polymerase sigma factor SigB
  • length: 256
  • theoretical pI: 5.645
  • theoretical MW: 29443.3
  • GRAVY: -0.616016

Function[edit | edit source]

  • TIGRFAM:
    RNA polymerase sigma-B factor (TIGR02941; HMM-score: 485.3)
    and 30 more
    RNA polymerase sigma-70 factor, sigma-B/F/G subfamily (TIGR02980; HMM-score: 303.8)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-F factor (TIGR02885; HMM-score: 179.8)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-F factor (TIGR02885; HMM-score: 179.8)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-G factor (TIGR02850; HMM-score: 145.1)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-G factor (TIGR02850; HMM-score: 145.1)
    RNA polymerase sigma factor, sigma-70 family (TIGR02937; HMM-score: 138.1)
    RNA polymerase sigma factor, FliA/WhiG family (TIGR02479; HMM-score: 119.6)
    RNA polymerase sigma factor, cyanobacterial RpoD-like family (TIGR02997; HMM-score: 92.6)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma factor RpoD (TIGR02393; HMM-score: 81.4)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-K factor (TIGR02846; HMM-score: 69.9)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-K factor (TIGR02846; HMM-score: 69.9)
    Cellular processes Cellular processes Adaptations to atypical conditions alternative sigma factor RpoH (TIGR02392; HMM-score: 67.8)
    Genetic information processing Transcription Transcription factors alternative sigma factor RpoH (TIGR02392; HMM-score: 67.8)
    Cellular processes Cellular processes Adaptations to atypical conditions RNA polymerase sigma factor RpoS (TIGR02394; HMM-score: 65.4)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma factor RpoS (TIGR02394; HMM-score: 65.4)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-E factor (TIGR02835; HMM-score: 63)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-E factor (TIGR02835; HMM-score: 63)
    RNA polymerase sigma-70 factor, Bacteroides expansion family 1 (TIGR02985; HMM-score: 47)
    RNA polymerase sigma-70 factor, Planctomycetaceae-specific subfamily 1 (TIGR02984; HMM-score: 35.8)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-H factor (TIGR02859; HMM-score: 35.1)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-H factor (TIGR02859; HMM-score: 35.1)
    RNA polymerase sigma-70 factor, TIGR02952 family (TIGR02952; HMM-score: 34)
    RNA polymerase sigma factor, SigZ family (TIGR02959; HMM-score: 26.3)
    RNA polymerase sigma-70 factor, sigma-E family (TIGR02983; HMM-score: 23.3)
    RNA polymerase sigma factor, TIGR02999 family (TIGR02999; HMM-score: 21.2)
    Cellular processes Cellular processes Sporulation and germination RNA polymerase sigma-I factor (TIGR02895; HMM-score: 19.7)
    Genetic information processing Transcription Transcription factors RNA polymerase sigma-I factor (TIGR02895; HMM-score: 19.7)
    RNA polymerase sigma-70 factor, Rhodopirellula/Verrucomicrobium family (TIGR02989; HMM-score: 18.8)
    RNA polymerase sigma-70 factor, Myxococcales family 1 (TIGR03001; HMM-score: 16.2)
    RNA polymerase sigma factor RpoE (TIGR02939; HMM-score: 13.7)
  • TheSEED: see SAUSA300_2022
  • PFAM:
    HTH (CL0123) Sigma70_r3; Sigma-70 region 3 (PF04539; HMM-score: 67.2)
    Sigma70_r2; Sigma-70 region 2 (PF04542; HMM-score: 66.6)
    Sigma70_r4; Sigma-70, region 4 (PF04545; HMM-score: 64)
    and 17 more
    Sigma70_r4_2; Sigma-70, region 4 (PF08281; HMM-score: 25.1)
    Sigma70_ECF; ECF sigma factor (PF07638; HMM-score: 23.4)
    GerE; Bacterial regulatory proteins, luxR family (PF00196; HMM-score: 21.5)
    HTH_Tnp_1; Transposase (PF01527; HMM-score: 18.9)
    HTH_16; Helix-turn-helix domain (PF12645; HMM-score: 18.5)
    HTH_23; Homeodomain-like domain (PF13384; HMM-score: 17.3)
    HTH_3; Helix-turn-helix (PF01381; HMM-score: 17)
    KORA; TrfB plasmid transcriptional repressor (PF16509; HMM-score: 16.7)
    HTH_28; Helix-turn-helix domain (PF13518; HMM-score: 16.3)
    IF2_N; Translation initiation factor IF-2, N-terminal region (PF04760; HMM-score: 15.4)
    HTH_38; Helix-turn-helix domain (PF13936; HMM-score: 14.8)
    HTH_AsnC-type; AsnC-type helix-turn-helix domain (PF13404; HMM-score: 14.5)
    no clan defined DUF6761; Family of unknown function (DUF6761) (PF20547; HMM-score: 13.3)
    HTH (CL0123) HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 12.9)
    NirdL-like_HTH; Siroheme decarboxylase NirDL-like HTH domain (PF22451; HMM-score: 12.6)
    PhyR_sigma-like; Response regulator PhyR, sigma-like domain (PF22233; HMM-score: 12.1)
    LysM (CL0187) LysM3_LYK4_5; LYK4/5 LysM3 domain (PF23473; HMM-score: 11.7)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • genes regulated by SigB*, sigma factor controlling a large regulon involved in stress/starvation response and adaptation: in COL, JSNZ, NCTC8325, Newman

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9917
    • Cytoplasmic Membrane Score: 0.0077
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0006
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007397
    • TAT(Tat/SPI): 0.000536
    • LIPO(Sec/SPII): 0.000631
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MAKESKSANEISPEQINQWIKEHQENKNTDAQDKLVKHYQKLIESLAYKYSKGQSHHEDLVQVGMVGLIGAINRFDMSFERKFEAFLVPTVIGEIKRYLRDKTWSVHVPRRIKEIGPRIKKVSDELTAELERSPSISEIADRLEVSEEEVLEAMEMGQSYNALSVDHSIEADKDGSTVTLLDIMGQQDDHYDLTEKRMILEKILPILSDREREIIQCTFIEGLSQKETGERIGLSQMHVSRLQRTAIKKLQEAAHQ

Experimental data[edit | edit source]

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]