Jump to navigation
		Jump to search
		
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_RS04820 [old locus tag: SAUSA300_0894 ]
- pan locus tag?: SAUPAN003151000
- symbol: SAUSA300_RS04820
- pan gene symbol?: opp4F
- synonym:
- product: ABC transporter ATP-binding protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_RS04820 [old locus tag: SAUSA300_0894 ]
- symbol: SAUSA300_RS04820
- product: ABC transporter ATP-binding protein
- replicon: chromosome
- strand: +
- coordinates: 982816..983796
- length: 981
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NC_007793 (982816..983796) NCBI
- BioCyc: SAUSA300_RS04820 BioCyc
- MicrobesOnline: see SAUSA300_0894
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
 61
 121
 181
 241
 301
 361
 421
 481
 541
 601
 661
 721
 781
 841
 901
 961ATGGAAAATATTTTAGAAGTCAACCAAATAAAAAAATACTACAAAATTAAAACTGGATTA
 TTACAAAAAACTCAGTACGTTAAAGCTGTTGATGACGTATCGTTTTCAATAAAAAAAGGA
 CAAACTTTTGGATTAGTAGGAGAATCGGGTTGTGGTAAGTCAACGTTAGGTAAAGTGATT
 ATCAGGCTTGAAGATGCAACTTCAGGCTCAATAATTGTTAATGGTGAAGATATAACAAGA
 TTACAAGGTAAAAAACTCAGAAAATCACGACAACAATATCAGATGATATTTCAAGATCCG
 TATGCATCATTGAATCCGATGCAAATGGTTGGAGATATCATTTCAGAACCTATTTTAAAT
 TATAAAAAATTGCCAAAAGAAGAAATAAAAAAAGAAGTACTATATTTATTAAAATGTGTT
 GGCCTAAGTGAAGATGCATATTATAAATATGCACATGAATTTTCAGGTGGACAGAGACAA
 AGAGTGGGAATTGCAAGAGCATTGGCTTTGCGTCCGAGTTTAATTGTTGCTGATGAGCCT
 GTAAGTGCATTAGATGTATCTGTTCAATCTCAAGTACTGAATTTATTAAAAGATTTACAA
 GAACAATTTAACTTAAGCTATTTATTTATCGCACATGATTTAAGTGTAGTAAAACATATA
 AGTGATGTCATTGGAGTTATGTATTTAGGTCATATAGTTGAAATCGCATCTGATAAAGAA
 ATTTATGAAAATCCCAAACATCCATATACAAAAGCGTTGATTTCATCAATACCACAAATT
 GATAAACATAATAACAATAGAATTATATTAAAAGGAGAATTACCTTCGCCAAGTAATCCG
 CCGCAAGGTTGTCCTTTTCATACAAGATGTCCAATTGCTCAAGATATGTGCAAAAAAAGT
 ATGCCAGAATTAAAGGACATTGGTAATGAACATCAAGTTGCTTGTTTCTACGTAGATAAA
 GTAGGTGATTTAAATGATTAA60
 120
 180
 240
 300
 360
 420
 480
 540
 600
 660
 720
 780
 840
 900
 960
 981
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_RS04820 [old locus tag: SAUSA300_0894 ]
- symbol: SAUSA300_RS04820
- description: ABC transporter ATP-binding protein
- length: 326
- theoretical pI: 8.32857
- theoretical MW: 36611.1
- GRAVY: -0.279755
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 252.5)and 77 moreTransport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 187.7)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 184.9)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 176.9)Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 174.3)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 163.7)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 157.9)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 155)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 147.3)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 145.8)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 145.3)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 143.7)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 139.9)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 136.7)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 136.6)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 127.9)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 127.9)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 125.8)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 123.8)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 120.7)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 113.9)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 109.4)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 108.5)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 108.5)Transport and binding proteins Amino acids, peptides and amines oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain (TIGR01727; HMM-score: 108.4)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 106.9)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 105.8)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 105.8)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 105.5)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 102.2)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 102.2)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 101.4)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 101.4)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 99.3)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 99)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 99)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 96.7)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 94.3)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 93.7)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 93.2)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 93.2)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 93)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 93)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 93)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 91.6)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 90.3)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 89.6)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 88.4)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 88)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 86.8)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 86.6)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 86.1)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 84.9)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 84.4)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 84.3)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 81.4)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 75.5)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 73.9)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 61.6)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 61.6)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 59.3)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 58.1)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 58.1)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 52.2)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 50.5)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 44.9)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 40.1)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 38.1)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 38.1)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 37.1)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 28.5)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 27.4)Cellular processes Pathogenesis type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 18.1)Protein fate Protein and peptide secretion and trafficking type III secretion apparatus H+-transporting two-sector ATPase (TIGR02546; EC 3.6.3.14; HMM-score: 18.1)Cellular processes Chemotaxis and motility flagellar protein export ATPase FliI (TIGR03497; EC 3.6.3.14; HMM-score: 16.2)Cellular processes Chemotaxis and motility flagellar protein export ATPase FliI (TIGR03496; EC 3.6.3.14; HMM-score: 15.5)Energy metabolism ATP-proton motive force interconversion ATPase, FliI/YscN family (TIGR01026; EC 3.6.3.14; HMM-score: 14.4)flagellar protein export ATPase FliI (TIGR03498; EC 3.6.3.14; HMM-score: 12.4)
- TheSEED: see SAUSA300_0894
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 113)and 10 moreno clan defined oligo_HPY; Oligopeptide/dipeptide transporter, C-terminal region (PF08352; HMM-score: 80.1)P-loop_NTPase (CL0023) SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 22.9)AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 20.1)ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 19)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 16.5)AAA_22; AAA domain (PF13401; HMM-score: 16.3)AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 13.9)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 13.3)TniB; Bacterial TniB protein (PF05621; HMM-score: 12)AAA_13; AAA domain (PF13166; HMM-score: 10.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane- Cytoplasmic Score: 1.05
- Cytoplasmic Membrane Score: 8.78
- Cellwall Score: 0.08
- Extracellular Score: 0.09
- Internal Helices: 0
 
- DeepLocPro: Cytoplasmic Membrane- Cytoplasmic Score: 0.081
- Cytoplasmic Membrane Score: 0.8772
- Cell wall & surface Score: 0.0003
- Extracellular Score: 0.0416
 
- LocateP:
- SignalP: no predicted signal peptide- SP(Sec/SPI): 0.100481
- TAT(Tat/SPI): 0.000478
- LIPO(Sec/SPII): 0.001323
 
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI: 446349915 NCBI
- RefSeq: WP_000427770 NCBI
- UniProt: see SAUSA300_0894
⊟Protein sequence[edit | edit source]
- MENILEVNQIKKYYKIKTGLLQKTQYVKAVDDVSFSIKKGQTFGLVGESGCGKSTLGKVIIRLEDATSGSIIVNGEDITRLQGKKLRKSRQQYQMIFQDPYASLNPMQMVGDIISEPILNYKKLPKEEIKKEVLYLLKCVGLSEDAYYKYAHEFSGGQRQRVGIARALALRPSLIVADEPVSALDVSVQSQVLNLLKDLQEQFNLSYLFIAHDLSVVKHISDVIGVMYLGHIVEIASDKEIYENPKHPYTKALISSIPQIDKHNNNRIILKGELPSPSNPPQGCPFHTRCPIAQDMCKKSMPELKDIGNEHQVACFYVDKVGDLND
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: CodY see SAUSA300_0894
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]