Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_1833 [new locus tag: SAUSA300_RS10015 ]
- pan locus tag?: SAUPAN004821000
- symbol: SAUSA300_1833
- pan gene symbol?: trnaL
- synonym:
- product: tRNA-Leu
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: tRNA
- locus tag: SAUSA300_1833 [new locus tag: SAUSA300_RS10015 ]
- symbol: SAUSA300_1833
- product: tRNA-Leu
- replicon: chromosome
- strand: -
- coordinates: 1997242..1997323
- length: 82
- essential: unknown
⊟Accession numbers[edit | edit source]
- Gene ID: 3915332 NCBI
- RefSeq:
- BioCyc: see SAUSA300_RS10015
- MicrobesOnline: 1293348 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61GCGGGTGTGGCGGAATTGGCAGACGCACTAGACTTAGGATCTAGCGCCTTACGGCGTGGG
GGTTCGACTCCCTTCACCCGCA60
82
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_1833 [new locus tag: SAUSA300_RS10015 ]
- symbol: SAUSA300_1833
- description: tRNA-Leu
- length:
- theoretical pI:
- theoretical MW:
- GRAVY:
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED:
- PFAM:
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb:
- DeepLocPro:
- LocateP:
- SignalP:
- predicted transmembrane helices (TMHMM):
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: SAUSA300_1813 < SAUSA300_1814 < SAUSA300_1815 < SAUSA300_1816 < SAUSA300_1817 < SAUSA300_1818 < SAUSA300_1819 < SAUSA300_1820 < SAUSA300_1821 < SAUSA300_1822 < SAUSA300_1823 < SAUSA300_1824 < SAUSA300_1825 < SAUSA300_1826 < SAUSA300_1827 < SAUSA300_1828 < SAUSA300_1829 < SAUSA300_1830 < SAUSA300_1831 < SAUSA300_1832 < SAUSA300_1833 < SAUSA300_1834 < SAUSA300_1835 < SAUSA300_1836 < rrfC
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]