From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus USA300_FPR3757
  • locus tag: SAUSA300_0684 [new locus tag: SAUSA300_RS03670 ]
  • pan locus tag?: SAUPAN002583000
  • symbol: fruB
  • pan gene symbol?: fruB
  • synonym:
  • product: fructose 1-phosphate kinase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_0684 [new locus tag: SAUSA300_RS03670 ]
  • symbol: fruB
  • product: fructose 1-phosphate kinase
  • replicon: chromosome
  • strand: +
  • coordinates: 757995..758915
  • length: 921
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGATTTATACAGTGACTTTCAATCCTTCAATTGACTATGTCATTTTTACGAATGATTTT
    AAAATTGATGGTTTGAACAGAGCAACAGCAACATATAAATTCGCTGGGGGGAAAGGTATT
    AATGTCTCGCGCGTCTTAAAGACATTGGATGTTGAGTCAACTGCCTTGGGATTTGCAGGT
    GGATTTCCTGGGAAATTCATTATAGATACATTAAATAACAGTGCAATTCAATCGAATTTT
    ATTGAAGTTGATGAAGATACACGTATTAATGTGAAATTAAAAACAGGACAAGAAACAGAA
    ATCAATGCACCGGGTCCTCATATAACGTCAACACAATTTGAACAACTGTTACAACAAATT
    AAAAATACAACAAGCGAAGATATAGTTATTGTTGCTGGAAGTGTACCAAGTAGTATTCCA
    AGCGATGCGTATGCGCAAATTGCACAAATTACAGCACAGACAGGTGCTAAATTAGTAGTC
    GACGCTGAAAAAGAATTGGCTGAAAGCGTTTTACCATATCATCCACTATTTATTAAACCT
    AATAAAGATGAATTAGAAGTGATGTTTAATACAACAGTGAACTCAGACACAGATGTTATT
    AAATATGGTCGTTTGTTAGTTGATAAAGGTGCGCAATCTGTTATTGTCTCGCTTGGCGGT
    GATGGTGCTATTTATATTGATAAAGAAATCAGTATTAAAGCAGTTAATCCACAAGGGAAA
    GTGGTTAATACAGTTGGCTCTGGTGATAGTACAGTTGCAGGCATGGTGGCTGGAATTGCT
    TCAGGTTTAACGATTGAAAAAGCATTCCAACAAGCAGTCGCATGCGGTACTGCCACGGCA
    TTTGATGAGGACTTAGCAACACGGGACGCTATAGAAAAAATAAAATCACAAGTTACGATT
    AGCGTACTTGATGGGGAGTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    921

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_0684 [new locus tag: SAUSA300_RS03670 ]
  • symbol: FruB
  • description: fructose 1-phosphate kinase
  • length: 306
  • theoretical pI: 4.39114
  • theoretical MW: 32572.6
  • GRAVY: 0.0248366

Function[edit | edit source]

  • reaction:
    EC 2.7.1.56?  ExPASy
    1-phosphofructokinase ATP + D-fructose 1-phosphate = ADP + D-fructose 1,6-bisphosphate
    EC 2.7.1.144?  ExPASy
    Tagatose-6-phosphate kinase ATP + D-tagatose 6-phosphate = ADP + D-tagatose 1,6-bisphosphate
  • TIGRFAM:
    1-phosphofructokinase (TIGR03828; EC 2.7.1.56; HMM-score: 355.2)
    hexose kinase, 1-phosphofructokinase family (TIGR03168; EC 2.7.1.-; HMM-score: 354.2)
    and 6 more
    Metabolism Energy metabolism Biosynthesis and degradation of polysaccharides tagatose-6-phosphate kinase (TIGR01231; EC 2.7.1.144; HMM-score: 178.7)
    Metabolism Energy metabolism Sugars ribokinase (TIGR02152; EC 2.7.1.15; HMM-score: 65.6)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides bifunctional protein RfaE, domain I (TIGR02198; EC 2.7.1.-; HMM-score: 52.9)
    Metabolism Energy metabolism Sugars 5-dehydro-2-deoxygluconokinase (TIGR04382; EC 2.7.1.92; HMM-score: 43.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase (TIGR00097; EC 2.7.1.49,2.7.4.7; HMM-score: 36.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridoxine pyridoxal kinase (TIGR00687; EC 2.7.1.35; HMM-score: 21.5)
  • TheSEED  :
    • 1-phosphofructokinase (EC 2.7.1.56)
    Carbohydrates Monosaccharides Fructose utilization  1-phosphofructokinase (EC 2.7.1.56)
  • PFAM:
    Ribokinase (CL0118) PfkB; pfkB family carbohydrate kinase (PF00294; HMM-score: 185.5)
    and 6 more
    Phos_pyr_kin; Phosphomethylpyrimidine kinase (PF08543; HMM-score: 35.9)
    Carb_kinase; NAD(P)H-hydrate dehydratase (PF01256; HMM-score: 24.7)
    NADP_Rossmann (CL0063) GRDA; Glycine reductase complex selenoprotein A (PF04723; HMM-score: 14.3)
    Beta_propeller (CL0186) Mala_s_1-like; Mal s 1 allergenic protein-like (PF22701; HMM-score: 14.3)
    HTH (CL0123) PuR_N; Bacterial purine repressor, N-terminal (PF09182; HMM-score: 13.7)
    no clan defined P34-Arc; Arp2/3 complex, 34 kD subunit p34-Arc (PF04045; HMM-score: 12.6)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: unknown (no significant prediction)
    • Cytoplasmic Score: 2.5
    • Cytoplasmic Membrane Score: 2.5
    • Cellwall Score: 2.5
    • Extracellular Score: 2.5
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9807
    • Cytoplasmic Membrane Score: 0.0126
    • Cell wall & surface Score: 0.0016
    • Extracellular Score: 0.0052
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.010086
    • TAT(Tat/SPI): 0.00061
    • LIPO(Sec/SPII): 0.000526
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MIYTVTFNPSIDYVIFTNDFKIDGLNRATATYKFAGGKGINVSRVLKTLDVESTALGFAGGFPGKFIIDTLNNSAIQSNFIEVDEDTRINVKLKTGQETEINAPGPHITSTQFEQLLQQIKNTTSEDIVIVAGSVPSSIPSDAYAQIAQITAQTGAKLVVDAEKELAESVLPYHPLFIKPNKDELEVMFNTTVNSDTDVIKYGRLLVDKGAQSVIVSLGGDGAIYIDKEISIKAVNPQGKVVNTVGSGDSTVAGMVAGIASGLTIEKAFQQAVACGTATAFDEDLATRDAIEKIKSQVTISVLDGE

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulators: FruR* (repression) regulon, CcpA regulon
    FruR*(TF)important in Fructose utilization; RegPrecise    transcription unit transferred from N315 data RegPrecise 
    CcpA(TF)important in Carbon catabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise 

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]