Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA0654 [new locus tag: SA_RS03730 ]
- pan locus tag?: SAUPAN002583000
- symbol: fruB
- pan gene symbol?: fruB
- synonym:
- product: fructose 1-phosphate kinase
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA0654 [new locus tag: SA_RS03730 ]
- symbol: fruB
- product: fructose 1-phosphate kinase
- replicon: chromosome
- strand: +
- coordinates: 747089..748009
- length: 921
- essential: yes [1] DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1123461 NCBI
- RefSeq: NP_373909 NCBI
- BioCyc: see SA_RS03730
- MicrobesOnline: 102935 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901ATGATTTATACAGTGACTTTCAATCCTTCAATTGACTATGTCATTTTTACGAATGATTTT
AAAATTGATGGTTTGAACAGAGCAACAGCAACATATAAATTCGCTGGGGGGAAAGGTATT
AATGTCTCGCGCGTCTTAAAGACATTAGATGTTGAGTCAACTGCCTTGGGATTTGCAGGT
GGATTTCCTGGGAAATTCATTATAGATACATTAAATAACAGTGCAATTCAATCGAATTTT
ATTGAAGTTGATGAAGATACACGTATTAATGTGAAATTAAAAACAGGACAAGAAACAGAA
ATCAATGCACCGGGTCCTCATATAACGTCAACACAATTTGAACAACTGTTACAACAAATT
AAAAATACAACAAGCGAAGATATAGTTATTGTTGCTGGAAGTGTACCAAGTAGTATTCCA
AGCGATGCGTATGCGCAAATTGCACAAATTACAGCACAGACAGGTGCTAAATTAGTAGTC
GACGCTGAAAAAGAATTGGCTGAAAGCGTTTTACCATTTCATCCACTATTTATTAAACCT
AATAAAGATGAATTAGAAGTGATGTTTAATACAACAGTGAACTCAGACACAGATGTTATT
AAATATGGTCGTTTGTTAGTTGATAAAGGTGCGCAATCTGTTATTGTCTCGCTTGGCGGT
GATGGTGCTATTTATATTGATAAAGAAATCAGTATTAAAGCAGTTAATCCACAAGGGAAA
GTGGTTAATACAGTTGGCTCTGGTGATAGTACAGTTGCAGGCATGGTGGCTGGAATTGCT
TCAGGTTTAACGATTGAAAAAGCATTCCAACAAGCAGTCGCATGCGGTACTGCCACGGCA
TTTGATGAGGACTTAGCAACACGGGACGCTATAGAAAAAATAAAATCACAAGTTACGATT
AGCGTACTTGATGGGGAGTGA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
921
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA0654 [new locus tag: SA_RS03730 ]
- symbol: FruB
- description: fructose 1-phosphate kinase
- length: 306
- theoretical pI: 4.39114
- theoretical MW: 32556.6
- GRAVY: 0.0382353
⊟Function[edit | edit source]
- reaction: EC 2.7.1.144? ExPASyTagatose-6-phosphate kinase ATP + D-tagatose 6-phosphate = ADP + D-tagatose 1,6-bisphosphate
- TIGRFAM: 1-phosphofructokinase (TIGR03828; EC 2.7.1.56; HMM-score: 354)hexose kinase, 1-phosphofructokinase family (TIGR03168; EC 2.7.1.-; HMM-score: 352.8)and 6 moreEnergy metabolism Biosynthesis and degradation of polysaccharides tagatose-6-phosphate kinase (TIGR01231; EC 2.7.1.144; HMM-score: 177.4)Energy metabolism Sugars ribokinase (TIGR02152; EC 2.7.1.15; HMM-score: 64.8)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides bifunctional protein RfaE, domain I (TIGR02198; EC 2.7.1.-; HMM-score: 52.1)Energy metabolism Sugars 5-dehydro-2-deoxygluconokinase (TIGR04382; EC 2.7.1.92; HMM-score: 42.9)Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase (TIGR00097; EC 2.7.1.49,2.7.4.7; HMM-score: 36.9)Biosynthesis of cofactors, prosthetic groups, and carriers Pyridoxine pyridoxal kinase (TIGR00687; EC 2.7.1.35; HMM-score: 21.6)
- TheSEED :
- 1-phosphofructokinase (EC 2.7.1.56)
- PFAM: Ribokinase (CL0118) PfkB; pfkB family carbohydrate kinase (PF00294; HMM-score: 183.8)and 6 morePhos_pyr_kin; Phosphomethylpyrimidine kinase (PF08543; HMM-score: 35.7)Carb_kinase; NAD(P)H-hydrate dehydratase (PF01256; HMM-score: 23.9)Beta_propeller (CL0186) Mala_s_1-like; Mal s 1 allergenic protein-like (PF22701; HMM-score: 14.8)NADP_Rossmann (CL0063) GRDA; Glycine reductase complex selenoprotein A (PF04723; HMM-score: 14.3)HTH (CL0123) PuR_N; Bacterial purine repressor, N-terminal (PF09182; HMM-score: 13.7)no clan defined P34-Arc; Arp2/3 complex, 34 kD subunit p34-Arc (PF04045; HMM-score: 11.6)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9808
- Cytoplasmic Membrane Score: 0.0125
- Cell wall & surface Score: 0.0016
- Extracellular Score: 0.0051
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.010086
- TAT(Tat/SPI): 0.00061
- LIPO(Sec/SPII): 0.000526
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MIYTVTFNPSIDYVIFTNDFKIDGLNRATATYKFAGGKGINVSRVLKTLDVESTALGFAGGFPGKFIIDTLNNSAIQSNFIEVDEDTRINVKLKTGQETEINAPGPHITSTQFEQLLQQIKNTTSEDIVIVAGSVPSSIPSDAYAQIAQITAQTGAKLVVDAEKELAESVLPFHPLFIKPNKDELEVMFNTTVNSDTDVIKYGRLLVDKGAQSVIVSLGGDGAIYIDKEISIKAVNPQGKVVNTVGSGDSTVAGMVAGIASGLTIEKAFQQAVACGTATAFDEDLATRDAIEKIKSQVTISVLDGE
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: SA0653 > fruB > fruA
⊟Regulation[edit | edit source]
- regulators: FruR* (repression) regulon, CcpA regulon
FruR* (TF) important in Fructose utilization; RegPrecise CcpA (TF) important in Carbon catabolism; RegPrecise
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
Mol Microbiol: 2002, 43(6);1387-400
[PubMed:11952893] [WorldCat.org] [DOI] (P p)