PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 02-MAR-2017

⊟Summary

• organism: Staphylococcus aureus COL
• locus tag: SACOL_RS12915 [old locus tag: SACOL2462 ]
• pan locus tag^?: SAUPAN006010000
• symbol: SACOL_RS12915
• pan gene symbol^?: —
• synonym:
• product: ABC transporter ATP-binding protein

⊟Genome View

⊟Gene

⊟General

• type: CDS
• locus tag: SACOL_RS12915 [old locus tag: SACOL2462 ]
• symbol: SACOL_RS12915
• product: ABC transporter ATP-binding protein
• replicon: chromosome
• strand: -
• coordinates: 2521028..2521690
• length: 663
• essential: unknown other strains

⊟Accession numbers

• Location: NC_002951 (2521028..2521690) NCBI
• BioCyc: SACOL_RS12915 BioCyc
• MicrobesOnline: see SACOL2462

⊟Phenotype

Share your knowledge and add information here. [edit]

⊟DNA sequence

• 1
  61
  121
  181
  241
  301
  361
  421
  481
  541
  601
  661
  
  ATGTTGTTAGAAATTAAAGATTTAGTGTATAAAGCGAGCGATAGAATCATACTAGATCAT
  ATCAGTCTAAAAGTAGATAAAGGCGAGAGTATTGCCATTATAGGTCCATCAGGTAGTGGT
  AAAAGTACATTTCAAAAGCAAATATGTAATTTGTTTAGTCCAACTAGTGGAGAACTTTAT
  TTTAAAGGTAAACCCTATAATGATTATGACCCGGAAGAATTGCGTCAACGAATCAGTTAT
  TTGATGCAGCAAAGTGACTTGTTTGGTGAAACGATTGAAGATAACATGATATTCCCATCA
  CTTGCACGTAATGATAAATTTGATAGAAAACGTGCAAAGCAATTAATTAAAGATGTCGGT
  TTGGGACATTATCAATTAAGTTCGGAAGTGGAAAATATGTCGGGTGGTGAGCGGCAAAGA
  ATTGCTATAGCGCGCCAACTGATGTATACACCGGATATTCTTTTATTAGATGAATCGACC
  AGTGCATTAGACGTTAATAATAAAGAAAAGATAGAAAATATCATTTTTAAATTAGCAGAT
  CAAGGCGTGGCAATTATGTGGATTACCCACAGCGATGACCAAAGTATGCGACACTTTCAA
  AAGCGTATAACAATTGTTGATGGTCAAATTTCTAATACAGAGGAGTTGAATCAACATGAG
  TAA
  60
  120
  180
  240
  300
  360
  420
  480
  540
  600
  660
  663
  

⊟Protein

⊟General

• locus tag: SACOL_RS12915 [old locus tag: SACOL2462 ]
• symbol: SACOL_RS12915
• description: ABC transporter ATP-binding protein
• length: 220
• theoretical pI: 5.16505
• theoretical MW: 25172.4
• GRAVY: -0.497273

⊟Function

• TIGRFAM:
  Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 138.7)
  Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 138.7)
  Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 136.2)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 136.2)
  Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 130.8)
  thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 130.6)
  Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 130.4)
  Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 129.8)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 128.8)
  Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 127.8)
  Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 127.8)
  thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 126.6)
  Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 126.4)
  ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 125.2)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 124.8)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 122.4)
  Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 122.4)
  Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 122.4)
  Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 121.8)
  Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 121.7)
  Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 121.7)
  Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 119.5)
  Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 119.5)
  Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 116.7)
  Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 114.2)
  Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 113.4)
  Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 112.2)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 111.2)
  and 49 more
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 110.2)
  Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 110.1)
  Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 109)
  ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 109)
  Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 106.5)
  Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 106.1)
  Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 106.1)
  Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 104.5)
  2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 100)
  Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 98)
  Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 95)
  lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 93.8)
  gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 92.6)
  ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 91.9)
  Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 90.6)
  Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 89.5)
  Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 89.5)
  D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 89.2)
  Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 88.1)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 86.9)
  Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 86.9)
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 86.3)
  Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 85)
  proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 83.5)
  Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 83.3)
  phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 82.5)
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 77.3)
  Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 76.7)
  Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 76)
  ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 74.1)
  Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 70.7)
  Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 68.7)
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 67.1)
  Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 65.7)
  Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 65.7)
  Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 62.8)
  Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 62.8)
  Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 56.8)
  Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 49.3)
  Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 48.9)
  Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 46.1)
  Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 46)
  Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 37.5)
  Metabolism Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 17.1)
  Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions cytidylate kinase (TIGR00017; EC 2.7.4.14; HMM-score: 15.3)
  P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 14.2)
  Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 14)
  Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 14)
  Cellular processes Cellular processes Sporulation and germination stage III sporulation protein AA (TIGR02858; HMM-score: 11.9)
• TheSEED: see SACOL2462
• PFAM:
  P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 114)
  and 27 more
  SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 30.4)
  AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 22)
  AAA_18; AAA domain (PF13238; HMM-score: 20.4)
  AAA_16; AAA ATPase domain (PF13191; HMM-score: 18)
  G-alpha; G-protein alpha subunit (PF00503; HMM-score: 17.7)
  RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 16.8)
  AAA_22; AAA domain (PF13401; HMM-score: 16.5)
  AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 16.3)
  PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 15.7)
  AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 15.6)
  AAA_24; AAA domain (PF13479; HMM-score: 15.4)
  AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 15.3)
  Cytidylate_kin; Cytidylate kinase (PF02224; HMM-score: 15.2)
  RNA_helicase; RNA helicase (PF00910; HMM-score: 15.1)
  NACHT; NACHT domain (PF05729; HMM-score: 14.9)
  AAA_33; AAA domain (PF13671; HMM-score: 14.9)
  SbcCD_C; Putative exonuclease SbcCD, C subunit (PF13558; HMM-score: 14.3)
  IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 14.2)
  DUF87; Domain of unknown function DUF87 (PF01935; HMM-score: 14.2)
  no clan defined Sigma70_r1_1; Sigma-70 factor, region 1.1 (PF03979; HMM-score: 13.5)
  P-loop_NTPase (CL0023) NB-ARC; NB-ARC domain (PF00931; HMM-score: 13.4)
  T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 13.1)
  ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 12.9)
  AAA_14; AAA domain (PF13173; HMM-score: 12.9)
  AAA_23; AAA domain (PF13476; HMM-score: 12.8)
  MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 12.6)
  AAA_25; AAA domain (PF13481; HMM-score: 11.6)

⊟Structure, modifications & cofactors

• domains:
• modifications:
• cofactors:
• effectors:

⊟Localization

• PSORTb: Cytoplasmic Membrane
  • Cytoplasmic Score: 0.01
  • Cytoplasmic Membrane Score: 9.99
  • Cellwall Score: 0
  • Extracellular Score: 0
  • Internal Helices: 0
• LocateP:
• SignalP: no predicted signal peptide
  • SP(Sec/SPI): 0.010872
  • TAT(Tat/SPI): 0.000604
  • LIPO(Sec/SPII): 0.001558
• predicted transmembrane helices (TMHMM): 0

⊟Accession numbers

• GI: 446846264 NCBI
• RefSeq: WP_000923520 NCBI
• UniProt: see SACOL2462

⊟Protein sequence

• MLLEIKDLVYKASDRIILDHISLKVDKGESIAIIGPSGSGKSTFQKQICNLFSPTSGELYFKGKPYNDYDPEELRQRISYLMQQSDLFGETIEDNMIFPSLARNDKFDRKRAKQLIKDVGLGHYQLSSEVENMSGGERQRIAIARQLMYTPDILLLDESTSALDVNNKEKIENIIFKLADQGVAIMWITHSDDQSMRHFQKRITIVDGQISNTEELNQHE

⊟Experimental data

• experimentally validated: see SACOL2462
• protein localization: see SACOL2462
• quantitative data / protein copy number per cell: see SACOL2462
• interaction partners:

⊟Expression & Regulation

⊟Operon

⊟Regulation

• regulator: SigB* see SACOL2462

⊟Transcription pattern

• S.aureus Expression Data Browser: data available for NCTC8325

⊟Protein synthesis (provided by Aureolib)

• Aureolib: no data available

⊟Protein stability

• half-life: no data available

⊟Biological Material

⊟Mutants

⊟Expression vector

⊟lacZ fusion

⊟GFP fusion

⊟two-hybrid system

⊟FLAG-tag construct

⊟Antibody

⊟Other Information

You are kindly invited to share additional interesting facts.

⊟Literature

⊟References

⊟Relevant publications