Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL_RS06255 [old locus tag: SACOL1221 ]
- pan locus tag?: SAUPAN003491000
- symbol: SACOL_RS06255
- pan gene symbol?: gmk
- synonym:
- product: guanylate kinase
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL_RS06255 [old locus tag: SACOL1221 ]
- symbol: SACOL_RS06255
- product: guanylate kinase
- replicon: chromosome
- strand: +
- coordinates: 1230617..1231240
- length: 624
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NC_002951 (1230617..1231240) NCBI
- BioCyc: SACOL_RS06255 BioCyc
- MicrobesOnline: see SACOL1221
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601ATGGATAATGAAAAAGGATTGTTAATCGTTTTATCAGGACCATCTGGAGTAGGTAAAGGT
ACTGTTAGAAAACGAATATTTGAAGATCCAAGTACATCATATAAGTATTCTATTTCAATG
ACAACACGTCAAATGCGTGAAGGTGAAGTTGATGGCGTAGATTACTTTTTTAAAACTAGG
GATGCGTTTGAAGCTTTAATCAAAGATGACCAATTTATAGAATATGCTGAATATGTAGGC
AACTATTATGGTACACCAGTTCAATATGTTAAAGATACAATGGACGAAGGTCATGATGTA
TTTTTAGAAATTGAAGTAGAAGGTGCAAAGCAAGTTAGAAAGAAATTTCCAGATGCGCTA
TTTATTTTCTTAGCACCTCCAAGTTTAGAACACTTGAGAGAGCGATTAGTAGGTAGAGGA
ACAGAATCTGATGAGAAAATACAAAGTCGTATTAACGAAGCGCGTAAAGAAGTTGAAATG
ATGAATTTATACGATTACGTTGTAGTTAATGATGAAGTAGAACTTGCGAAGAATAGAATT
CAATGTATTGTAGAAGCTGAGCACTTAAAAAGAGAGCGCGTAGAAGCTAAGTATAGAAAA
ATGATTTTGGAGGCTAAAAAATAA60
120
180
240
300
360
420
480
540
600
624
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL_RS06255 [old locus tag: SACOL1221 ]
- symbol: SACOL_RS06255
- description: guanylate kinase
- length: 207
- theoretical pI: 5.10267
- theoretical MW: 24037.2
- GRAVY: -0.579227
⊟Function[edit | edit source]
- reaction: EC 2.7.4.8? ExPASyGuanylate kinase ATP + GMP = ADP + GDP
- TIGRFAM: Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions guanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 238.9)and 5 moreCentral intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 47.8)Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 19)putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 14.1)Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions adenylate kinase (TIGR01351; EC 2.7.4.-; HMM-score: 13.5)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 12.4)
- TheSEED: see SACOL1221
- PFAM: P-loop_NTPase (CL0023) Guanylate_kin; Guanylate kinase (PF00625; HMM-score: 173.2)and 10 moreAAA_18; AAA domain (PF13238; HMM-score: 17.7)AAA_33; AAA domain (PF13671; HMM-score: 16.5)ABC_tran; ABC transporter (PF00005; HMM-score: 14.4)AAA_17; AAA domain (PF13207; HMM-score: 14)AAA_22; AAA domain (PF13401; HMM-score: 13.8)Rad17; Rad17 P-loop domain (PF03215; HMM-score: 13.6)AAA_16; AAA ATPase domain (PF13191; HMM-score: 13.3)NB-ARC; NB-ARC domain (PF00931; HMM-score: 13.2)MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 12.8)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 11.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9915
- Cytoplasmic Membrane Score: 0.0004
- Cell wall & surface Score: 0
- Extracellular Score: 0.0081
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.006276
- TAT(Tat/SPI): 0.000768
- LIPO(Sec/SPII): 0.002138
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MDNEKGLLIVLSGPSGVGKGTVRKRIFEDPSTSYKYSISMTTRQMREGEVDGVDYFFKTRDAFEALIKDDQFIEYAEYVGNYYGTPVQYVKDTMDEGHDVFLEIEVEGAKQVRKKFPDALFIFLAPPSLEHLRERLVGRGTESDEKIQSRINEARKEVEMMNLYDYVVVNDEVELAKNRIQCIVEAEHLKRERVEAKYRKMILEAKK
⊟Experimental data[edit | edit source]
- experimentally validated: see SACOL1221
- protein localization: see SACOL1221
- quantitative data / protein copy number per cell: see SACOL1221
- interaction partners:
SACOL_RS01135 L-lactate dehydrogenase [1] (data from MRSA252) SACOL_RS02145 acetyl-CoA acyltransferase [1] (data from MRSA252) SACOL_RS02200 30S ribosomal protein S6 [1] (data from MRSA252) SACOL_RS02930 pyridoxal 5'-phosphate synthase lyase subunit PdxS [1] (data from MRSA252) SACOL_RS03035 50S ribosomal protein L10 [1] (data from MRSA252) SACOL_RS03040 50S ribosomal protein L7/L12 [1] (data from MRSA252) SACOL_RS03755 LysR family transcriptional regulator [1] (data from MRSA252) SACOL_RS04310 aldehyde dehydrogenase [1] (data from MRSA252) SACOL_RS04325 2,3-bisphosphoglycerate-independent phosphoglycerate mutase [1] (data from MRSA252) SACOL_RS04330 enolase [1] (data from MRSA252) SACOL_RS04950 glucose-6-phosphate isomerase [1] (data from MRSA252) SACOL_RS05135 oligoendopeptidase F [1] (data from MRSA252) SACOL_RS05205 hypothetical protein [1] (data from MRSA252) SACOL_RS05470 bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase [1] (data from MRSA252) SACOL_RS05570 phosphocarrier protein HPr [1] (data from MRSA252) SACOL_RS05900 thiol reductase thioredoxin [1] (data from MRSA252) SACOL_RS06140 cell division protein FtsZ [1] (data from MRSA252) SACOL_RS06175 isoleucine--tRNA ligase [1] (data from MRSA252) SACOL_RS06365 beta-ketoacyl-ACP reductase [1] (data from MRSA252) SACOL_RS06445 succinyl-CoA ligase subunit beta [1] (data from MRSA252) SACOL_RS06770 glutamine synthetase [1] (data from MRSA252) SACOL_RS07390 2-oxoglutarate dehydrogenase E1 component [1] (data from MRSA252) SACOL_RS07720 30S ribosomal protein S1 [1] (data from MRSA252) SACOL_RS08270 glycine--tRNA ligase [1] (data from MRSA252) SACOL_RS08520 hypothetical protein [1] (data from MRSA252) SACOL_RS08905 isocitrate dehydrogenase (NADP(+)) [1] (data from MRSA252) SACOL_RS10530 molecular chaperone GroEL [1] (data from MRSA252) SACOL_RS11075 fructose-bisphosphate aldolase [1] (data from MRSA252) SACOL_RS11615 30S ribosomal protein S9 [1] (data from MRSA252) SACOL_RS11645 50S ribosomal protein L17 [1] (data from MRSA252) SACOL_RS11685 50S ribosomal protein L15 [1] (data from MRSA252) SACOL_RS11755 50S ribosomal protein L22 [1] (data from MRSA252) SACOL_RS13725 malate:quinone oxidoreductase [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.00 1.01 1.02 1.03 1.04 1.05 1.06 1.07 1.08 1.09 1.10 1.11 1.12 1.13 1.14 1.15 1.16 1.17 1.18 1.19 1.20 1.21 1.22 1.23 1.24 1.25 1.26 1.27 1.28 1.29 1.30 1.31 1.32 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)