From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS00940 [old locus tag: SACOL0184 ]
  • pan locus tag?: SAUPAN001056000
  • symbol: SACOL_RS00940
  • pan gene symbol?: gisA
  • synonym:
  • product: ABC transporter ATP-binding protein

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS00940 [old locus tag: SACOL0184 ]
  • symbol: SACOL_RS00940
  • product: ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: -
  • coordinates: 214315..215907
  • length: 1593
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

  • Location: NC_002951 (214315..215907) NCBI
  • BioCyc: SACOL_RS00940 BioCyc
  • MicrobesOnline: see SACOL0184

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    1441
    1501
    1561
    ATGTCAAATTTATTAGAAGTCAACAGTCTGAATGTACAATTCAATTATGATGAAACTACA
    GTTCAAGCGGTAAAAAACGTCTCTTTCGAATTACGAAAAAAACATATCCTAGGTATTGTT
    GGTGAATCAGGATCAGGAAAAAGTATTACCGCTAAATCTATTTTAGGGCTACTACCAGAT
    TATCCAGATCACACATTAACAGGAGAAATTATTTTTAATGGGCAATCGTTAAATAATTTA
    TCAACTTCAGCGTTACAACAAATTCGAGGTAAGGATATTTCAATGATTTTTCAAGATCCA
    CTCTCTTCGTTGAATCCAAGATTAACGATTGGCAAACAAATTACAGAAGTAATATTTCAA
    CATAAACGTGTATCTAAATCTGAAGCAAAGTCGATGACAATAGACATTTTAGAAAAAGTA
    GGTATAAAACATGCAACTCGACAATTTGATGCTTATCCACATGAACTTTCTGGTGGTATG
    CGTCAACGTGTCATGATAGCAATGGCATTGATTTTAAAGCCACAAATTTTAATCGCAGAT
    GAACCAACAACGGCATTAGATGCCAGTACACAAAATCAATTACTGCAGTTAATGAAGTCC
    CTTTATGAGTACACAGAAACATCTATTATTTTTATCACTCACGATTTAGGCGCTGTGTAT
    CAATTTTGCGACGATGTGATTGTAATGAAAGATGGAAGTGTCGTTGAAAGTGGCACGGTT
    GAAAGTATTTTTAAATCGCCACAACATACCTATACAAAACGCTTAATAGATGCGATTCCT
    GATATTCATCAAACGCGTCCGCCAAGACCGTTAAACAATGATATTTTATTAAAATTCGAT
    CGCGTGAGCGTGGATTACACATCACCGAGTGGCAGCCTATACCGAGCAGTTAATGATATT
    AACTTGGCTATTAGAAAAGGCGAAACATTAGGCATTGTCGGTGAATCAGGGTCAGGGAAA
    TCGACATTAGCTAAGACGGTCGTCGGTCTAAAGGAAGTGTCAGAAGGCTTTATTTGGTAT
    AACGAATTACCATTAAGTTTATTTAAAGATGATGAATTGAAATCTTTACGACAAGAGATA
    CAAATGATTTTTCAAGATCCATTCGCATCTATTAATCCAAGATTTAAAGTCATTGATGTG
    ATTAAACGACCACTAATCATTCATGGGAAAGTCAAAGATAATGATGACATTATTAAAACT
    GTCGTATCGTTGTTAGAAAAGGTTGGCCTAGATCAAACTTTCTTATATCGCTATCCACAC
    GAATTATCTGGTGGGCAACGTCAGCGTGTAAGTATCGCGAGAGCACTTGCTGTTGAACCT
    AAAGTGATTGTTTGCGACGAGGCAGTGTCCGCTTTAGACGTTTCAATTCAAAAAGATATC
    ATCGAGTTATTAAAACAATTACAGTTAGACTTCGGCATCACTTATTTATTCATCACACAT
    GACATGGGTGTTATCAATGAAATATGTGATCGCGTTGCAGTTATGAAAAATGGCGAAATC
    GTTGAACTGAATAACACAGAAGATATTATCAAACATCCGCAGTCAGACTATGCAAAGCAA
    CTTATTTCAGAAGTAGCAGTTATTGCTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1440
    1500
    1560
    1593


⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SACOL_RS00940 [old locus tag: SACOL0184 ]
  • symbol: SACOL_RS00940
  • description: ABC transporter ATP-binding protein
  • length: 530
  • theoretical pI: 6.25442
  • theoretical MW: 59175.8
  • GRAVY: -0.08

⊟Function[edit | edit source]

  • TIGRFAM:
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 447.4)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 410.8)
    and 79 more
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 332.1)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 325.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 323.7)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 305.3)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 290)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 289.6)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 278.5)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 276.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 274.8)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 271)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 267.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 261.2)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 259.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 245.5)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 233.7)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 233.7)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 230.8)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 230.1)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 226)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 217.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 217.4)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 214.9)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 213.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 213.2)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 212.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 212.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 211.6)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 207.8)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 200.7)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 200.7)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 196.1)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 196.1)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 196.1)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 192.6)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 191.6)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 186.6)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 186.6)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 184.9)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 184.9)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 184.2)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 181.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 180.7)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 179.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 179)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 178.1)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 177.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 173.9)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 169.9)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 165.8)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 161.6)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 159.3)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 153.9)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 143.2)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 143.2)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 142.1)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 138.9)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 135.6)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 132.4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 112.6)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 112.6)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 110.5)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 96.2)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 85.1)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 85.1)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 80.8)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 77.9)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 68.4)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 68.3)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 65.1)
    Metabolism Transport and binding proteins Amino acids, peptides and amines oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain (TIGR01727; HMM-score: 42)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 19.3)
    P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 17.5)
    Metabolism Central intermediary metabolism Sulfur metabolism adenylyl-sulfate kinase (TIGR00455; EC 2.7.1.25; HMM-score: 15.2)
    Genetic information processing Protein fate Degradation of proteins, peptides, and glycopeptides putative ATP-dependent protease (TIGR00764; HMM-score: 15.2)
    Unknown function General Mg chelatase-like protein (TIGR00368; HMM-score: 13.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type VII secretion protein EssC (TIGR03928; HMM-score: 11.8)
    Metabolism Central intermediary metabolism Nitrogen fixation Nif-specific regulatory protein (TIGR01817; HMM-score: 11.4)
    Signal transduction Regulatory functions DNA interactions Nif-specific regulatory protein (TIGR01817; HMM-score: 11.4)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 8.7)
  • TheSEED: see SACOL0184
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 223.1)
    and 48 more
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 53.1)
    AAA_22; AAA domain (PF13401; HMM-score: 41.6)
    no clan defined oligo_HPY; Oligopeptide/dipeptide transporter, C-terminal region (PF08352; HMM-score: 40.2)
    P-loop_NTPase (CL0023) AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 34.8)
    nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 29.3)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 26.5)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 26.1)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 24.7)
    ABC_ATPase; P-loop domain (PF09818; HMM-score: 23.4)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 23)
    Sigma54_activat; Sigma-54 interaction domain (PF00158; HMM-score: 22.8)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 22.8)
    nSTAND1; Novel STAND NTPase 1 (PF20703; HMM-score: 22.5)
    DUF87; Helicase HerA, central domain (PF01935; HMM-score: 22.3)
    NPHP3_N; Nephrocystin 3, N-terminal (PF24883; HMM-score: 22)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 21.6)
    AAA_33; AAA domain (PF13671; HMM-score: 20.9)
    NACHT; NACHT domain (PF05729; HMM-score: 20.2)
    AAA_23; AAA domain (PF13476; HMM-score: 19.3)
    AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 18.9)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 18.8)
    AAA_19; AAA domain (PF13245; HMM-score: 18.4)
    DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 17.5)
    AAA_24; AAA domain (PF13479; HMM-score: 17.4)
    AAA_18; AAA domain (PF13238; HMM-score: 17.3)
    ATP-synt_ab; ATP synthase alpha/beta family, nucleotide-binding domain (PF00006; HMM-score: 17)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 16.6)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 16.2)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 16)
    PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 15.8)
    Rad17; Rad17 P-loop domain (PF03215; HMM-score: 15.7)
    Sigma54_activ_2; Sigma-54 interaction domain (PF14532; HMM-score: 15.5)
    SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 14.9)
    PhoH; PhoH-like protein (PF02562; HMM-score: 14.1)
    ATPase; KaiC (PF06745; HMM-score: 13.7)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 13.4)
    FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 13.2)
    MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 12.6)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 12.3)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 12)
    Cache (CL0165) dCache_2; Cache domain (PF08269; HMM-score: 11.6)
    P-loop_NTPase (CL0023) G-alpha; G-protein alpha subunit (PF00503; HMM-score: 11.4)
    AAA_13; AAA domain (PF13166; HMM-score: 11.4)
    no clan defined DUF3987; Protein of unknown function (DUF3987) (PF13148; HMM-score: 10.6)
    P-loop_NTPase (CL0023) AAA_15; AAA ATPase domain (PF13175; HMM-score: 9.9)
    SLFN-g3_helicase; Schlafen group 3, DNA/RNA helicase domain (PF09848; HMM-score: 9.8)
    AIG1; AIG1 family (PF04548; HMM-score: 9.5)
    AAA_10; AAA-like domain (PF12846; HMM-score: 9.3)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.04
    • Cytoplasmic Membrane Score: 9.96
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.1213
    • Cytoplasmic Membrane Score: 0.8609
    • Cell wall & surface Score: 0.0007
    • Extracellular Score: 0.0171
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.006678
    • TAT(Tat/SPI): 0.000447
    • LIPO(Sec/SPII): 0.000277
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MSNLLEVNSLNVQFNYDETTVQAVKNVSFELRKKHILGIVGESGSGKSITAKSILGLLPDYPDHTLTGEIIFNGQSLNNLSTSALQQIRGKDISMIFQDPLSSLNPRLTIGKQITEVIFQHKRVSKSEAKSMTIDILEKVGIKHATRQFDAYPHELSGGMRQRVMIAMALILKPQILIADEPTTALDASTQNQLLQLMKSLYEYTETSIIFITHDLGAVYQFCDDVIVMKDGSVVESGTVESIFKSPQHTYTKRLIDAIPDIHQTRPPRPLNNDILLKFDRVSVDYTSPSGSLYRAVNDINLAIRKGETLGIVGESGSGKSTLAKTVVGLKEVSEGFIWYNELPLSLFKDDELKSLRQEIQMIFQDPFASINPRFKVIDVIKRPLIIHGKVKDNDDIIKTVVSLLEKVGLDQTFLYRYPHELSGGQRQRVSIARALAVEPKVIVCDEAVSALDVSIQKDIIELLKQLQLDFGITYLFITHDMGVINEICDRVAVMKNGEIVELNNTEDIIKHPQSDYAKQLISEVAVIAK

⊟Experimental data[edit | edit source]

  • experimentally validated: see SACOL0184
  • protein localization: see SACOL0184
  • quantitative data / protein copy number per cell:
  • interaction partners:
    SACOL_RS03080elongation factor Tu  [1] (data from MRSA252)
    SACOL_RS05645dihydrolipoyl dehydrogenase  [1] (data from MRSA252)
    SACOL_RS1169530S ribosomal protein S5  [1] (data from MRSA252)

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ 1.0 1.1 1.2 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]