From AureoWiki
Jump to navigation Jump to search

NCBI: 10-JUN-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0254 [new locus tag: SACOL_RS01295 ]
  • pan locus tag?: SAUPAN001155000
  • symbol: SACOL0254
  • pan gene symbol?: rbsD
  • synonym:
  • product: D-ribose pyranase

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SACOL0254 [new locus tag: SACOL_RS01295 ]
  • symbol: SACOL0254
  • product: D-ribose pyranase
  • replicon: chromosome
  • strand: -
  • coordinates: 294763..295167
  • length: 405
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGAAAAAATCAGCTGTTTTAAATGAACATATTTCAAAAGCAATCGCGACAATTGGTCAT
    TTTGATTTATTAACGATTAATGACGCTGGCATGCCAATTCCAAATGATCATCGTCGTATC
    GACCTAGCTGTAACTAAAAACTTACCACGCTTTATTGATGTCTTAGCTACAGTGTTAGAA
    GAAATGGAAATCCAAAAAATATACTTAGCAGAAGAAATAAAAGAACATAACCCTACACAA
    TTGCAACAAATTAAACAATTGATTTCATCGGAAATCGAAATCATTTTCATTCCTCACGAA
    GAAATGAAAAGTAACTTAGCTCACCCATTAAATAAAGGTAATATTCGTACTGGTGAAACA
    ACGCCCTACTCTAATATTGCATTAGAATCGAATGTTACTTTTTAA
    60
    120
    180
    240
    300
    360
    405


⊟Protein[edit | edit source]

Protein Data Bank: 3P12
Protein Data Bank: 3P13

⊟General[edit | edit source]

  • locus tag: SACOL0254 [new locus tag: SACOL_RS01295 ]
  • symbol: SACOL0254
  • description: D-ribose pyranase
  • length: 134
  • theoretical pI: 5.9179
  • theoretical MW: 15165.4
  • GRAVY: -0.214179

⊟Function[edit | edit source]

  • reaction:
    EC 5.4.99.62?  ExPASy
    D-ribose pyranase Beta-D-ribopyranose = beta-D-ribofuranose
  • TIGRFAM:
  • TheSEED  :
    • D-ribose pyranase (EC 5.4.99.62)
    Carbohydrates Monosaccharides D-ribose utilization  Ribose ABC transport system, high affinity permease RbsD (TC 3.A.1.2.1)
  • PFAM:
    PELOTA (CL0101) RbsD_FucU; RbsD / FucU transport protein family (PF05025; HMM-score: 134.6)
    and 1 more
    no clan defined Myb_Cef; pre-mRNA splicing factor component (PF11831; HMM-score: 15.5)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9982
    • Cytoplasmic Membrane Score: 0.0003
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.0014
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 0
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003241
    • TAT(Tat/SPI): 0.000164
    • LIPO(Sec/SPII): 0.000854
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MKKSAVLNEHISKAIATIGHFDLLTINDAGMPIPNDHRRIDLAVTKNLPRFIDVLATVLEEMEIQKIYLAEEIKEHNPTQLQQIKQLISSEIEIIFIPHEEMKSNLAHPLNKGNIRTGETTPYSNIALESNVTF

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3]
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator: CcpA regulon
    CcpA(TF)important in Carbon catabolism; RegPrecise    transcription unit transferred from N315 data RegPrecise 

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

⊟Relevant publications[edit | edit source]