Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL0254 [new locus tag: SACOL_RS01295 ]
- pan locus tag?: SAUPAN001155000
- symbol: SACOL0254
- pan gene symbol?: rbsD
- synonym:
- product: D-ribose pyranase
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL0254 [new locus tag: SACOL_RS01295 ]
- symbol: SACOL0254
- product: D-ribose pyranase
- replicon: chromosome
- strand: -
- coordinates: 294763..295167
- length: 405
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3236689 NCBI
- RefSeq: YP_185150 NCBI
- BioCyc: see SACOL_RS01295
- MicrobesOnline: 911728 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGAAAAAATCAGCTGTTTTAAATGAACATATTTCAAAAGCAATCGCGACAATTGGTCAT
TTTGATTTATTAACGATTAATGACGCTGGCATGCCAATTCCAAATGATCATCGTCGTATC
GACCTAGCTGTAACTAAAAACTTACCACGCTTTATTGATGTCTTAGCTACAGTGTTAGAA
GAAATGGAAATCCAAAAAATATACTTAGCAGAAGAAATAAAAGAACATAACCCTACACAA
TTGCAACAAATTAAACAATTGATTTCATCGGAAATCGAAATCATTTTCATTCCTCACGAA
GAAATGAAAAGTAACTTAGCTCACCCATTAAATAAAGGTAATATTCGTACTGGTGAAACA
ACGCCCTACTCTAATATTGCATTAGAATCGAATGTTACTTTTTAA60
120
180
240
300
360
405
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL0254 [new locus tag: SACOL_RS01295 ]
- symbol: SACOL0254
- description: D-ribose pyranase
- length: 134
- theoretical pI: 5.9179
- theoretical MW: 15165.4
- GRAVY: -0.214179
⊟Function[edit | edit source]
- reaction: EC 5.4.99.62? ExPASyD-ribose pyranase Beta-D-ribopyranose = beta-D-ribofuranose
- TIGRFAM:
- TheSEED :
- D-ribose pyranase (EC 5.4.99.62)
- PFAM: PELOTA (CL0101) RbsD_FucU; RbsD / FucU transport protein family (PF05025; HMM-score: 134.6)and 1 moreno clan defined Myb_Cef; pre-mRNA splicing factor component (PF11831; HMM-score: 15.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9982
- Cytoplasmic Membrane Score: 0.0003
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.0014
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 0
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.003241
- TAT(Tat/SPI): 0.000164
- LIPO(Sec/SPII): 0.000854
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MKKSAVLNEHISKAIATIGHFDLLTINDAGMPIPNDHRRIDLAVTKNLPRFIDVLATVLEEMEIQKIYLAEEIKEHNPTQLQQIKQLISSEIEIIFIPHEEMKSNLAHPLNKGNIRTGETTPYSNIALESNVTF
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2] [3]
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: CcpA regulon
CcpA (TF) important in Carbon catabolism; RegPrecise transcription unit transferred from N315 data RegPrecise
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p)