⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA2480 [new locus tag: SA_RS14190 ]
- pan locus tag?: SAUPAN006445000
- symbol: drp35
- pan gene symbol?: drp35
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA2480 [new locus tag: SA_RS14190 ]
- symbol: drp35
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 2791468..2792442
- length: 975
- essential: no DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1125410 NCBI
- RefSeq: NP_375807 NCBI
- BioCyc: see SA_RS14190
- MicrobesOnline: 104833 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961ATGATGTCACAACAAGATTTACCTACATTATTTTATAGCGGGAAGTCCAATAGTGCTGTT
CCAATTATATCTGAAAGTGAATTACAAACAATTACAGCTGAACCATGGCTTGAAATTTCC
AAAAAAGGATTGCAACTAGAAGGATTGAACTTTGATCGGCAGGGACAACTCTTTTTATTG
GATGTATTCGAAGGCAATATTTTCAAAATCAATCCTGAAACGAAGGAAATCAAACGACCT
TTTGTAAGTCACAAAGCGAATCCTGCAGCAATCAAAATACATAAAGATGGCCGATTATTC
GTTTGTTATTTAGGAGATTTTAAATCTACAGGAGGCATTTTTGCAGCTACAGAAAATGGT
GACAACTTACAAGATATTATTGAAGATCTTTCAACAGCATATTGTATTGATGACATGGTA
TTTGATTCTAAAGGTGGATTTTATTTTACAGATTTTAGAGGATACTCTACCAATCCACTA
GGAGGCGTTTATTATGTTTCGCCGGACTTTAGAACAGTGACGCCTATCATTCAAAATATT
AGCGTAGCAAATGGTATTGCTTTAAGTACAGATGAAAAAGTACTATGGGTAACAGAAACT
ACAGCCAATCGATTACATCGCATTGCACTTGAAGATGATGGTGTGACGATACAACCATTT
GGAGCTACTATACCGTACTATTTTACAGGTCATGAAGGACCAGACTCATGTTGTATTGAT
AGTGACGATAATTTATACGTAGCAATGTATGGTCAAGGTCGAGTGTTAGTTTTTAATAAA
AGGGGTTATCCAATAGGACAAATATTGATACCAGGCCGAGATGAAGGGCATATGTTACGT
TCTACTCATCCGCAATTTATACCTGGAACAAATCAACTCATCATTTGTTCCAATGATATA
GAAATGGGCGGAGGATCTATGCTTTATACAGTTAATGGCTTTGCAAAAGGTCATCAAAGT
TTTCAGTTTCAATAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
975
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA2480 [new locus tag: SA_RS14190 ]
- symbol: Drp35
- description: hypothetical protein
- length: 324
- theoretical pI: 4.71521
- theoretical MW: 35963.4
- GRAVY: -0.186111
⊟Function[edit | edit source]
- reaction: EC 3.1.1.-? ExPASy
- TIGRFAM:
- TheSEED :
- Lactonase Drp35
- PFAM: Beta_propeller (CL0186) SGL; SMP-30/Gluconolactonase/LRE-like region (PF08450; HMM-score: 100.9)and 5 moreArylesterase; Arylesterase (PF01731; HMM-score: 28.9)Str_synth; Strictosidine synthase (PF03088; HMM-score: 27.7)NHL; NHL repeat (PF01436; HMM-score: 24.2)Mala_s_1-like; Mal s 1 allergenic protein-like (PF22701; HMM-score: 17.8)Vgb_lyase; Virginiamycin B lyase family (PF24684; HMM-score: 17.8)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors: Ca2+
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 10
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.936
- Cytoplasmic Membrane Score: 0.033
- Cell wall & surface Score: 0.0004
- Extracellular Score: 0.0307
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.003819
- TAT(Tat/SPI): 0.000162
- LIPO(Sec/SPII): 0.000557
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MMSQQDLPTLFYSGKSNSAVPIISESELQTITAEPWLEISKKGLQLEGLNFDRQGQLFLLDVFEGNIFKINPETKEIKRPFVSHKANPAAIKIHKDGRLFVCYLGDFKSTGGIFAATENGDNLQDIIEDLSTAYCIDDMVFDSKGGFYFTDFRGYSTNPLGGVYYVSPDFRTVTPIIQNISVANGIALSTDEKVLWVTETTANRLHRIALEDDGVTIQPFGATIPYYFTGHEGPDSCCIDSDDNLYVAMYGQGRVLVFNKRGYPIGQILIPGRDEGHMLRSTHPQFIPGTNQLIICSNDIEMGGGSMLYTVNGFAKGHQSFQFQ
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator: CcpA regulon
CcpA (TF) important in Carbon catabolism; RegPrecise
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
⊟Relevant publications[edit | edit source]
Alexander Scherl, Patrice François, Manuela Bento, Jacques M Deshusses, Yvan Charbonnier, Véronique Converset, Antoine Huyghe, Nadia Walter, Christine Hoogland, Ron D Appel, Jean-Charles Sanchez, Catherine G Zimmermann-Ivol, Garry L Corthals, Denis F Hochstrasser, Jacques Schrenzel
Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth.
J Microbiol Methods: 2005, 60(2);247-57
[PubMed:15590099] [WorldCat.org] [DOI] (P p)Kazuya Morikawa, Toshie Hidaka, Hiroyuki Murakami, Hideo Hayashi, Toshiko Ohta
Staphylococcal Drp35 is the functional counterpart of the eukaryotic PONs.
FEMS Microbiol Lett: 2005, 249(1);185-90
[PubMed:16019162] [WorldCat.org] [DOI] (P p)