Jump to navigation
Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR3757JSNZ04-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA1248
- pan locus tag?: SAUPAN003836000
- symbol: SA1248
- pan gene symbol?: truncated ArlR
- synonym:
- product: truncated ( response regulator ArlR [S
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA1248
- symbol: SA1248
- product: truncated ( response regulator ArlR [S
- replicon: chromosome
- strand: -
- coordinates: 1423786..1424187
- length: 402
- essential: no DEG
⊟Accession numbers[edit | edit source]
- Gene ID: 1124086 NCBI
- RefSeq: NP_374529 NCBI
- BioCyc:
- MicrobesOnline: 103555 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361ATGACGCAAATTTTAATAGTAGAAGATGAACAAAACTTAGCAAGATTTCTTGAATTGGAA
CTCACACATGAAAATTACAATGTGGACACAGAGTATGATGGACAAGACGGTTTAGATAAA
GCGCTTAGCCATTACTATGATTTAATCATATTAGATTTAATGTTGCCGTCAATTAATGGC
TTAGAAATTTGTCGCAAAATTAGACAACAACAATCTACACCTATCATTATAATTACAGCG
AAAAGTGATACGTATGACAAAGTTGCTGGGCTTGATTACGGTGCAGACGATTATATAGTT
AAGCCGTTTGATATTGAAGAACTTTTAGCAAGAATTCGTGCAATTTTACGTCGTCAGCCA
CAAAAGGATATTATCGATGTCAACGGAACGCTTTTAAAGTGA60
120
180
240
300
360
402
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA1248
- symbol: SA1248
- description: truncated ( response regulator ArlR [S
- length: 133
- theoretical pI: 4.2924
- theoretical MW: 15309.4
- GRAVY: -0.22782
⊟Function[edit | edit source]
- TIGRFAM: Regulatory functions DNA interactions heavy metal response regulator (TIGR01387; HMM-score: 136.6)Regulatory functions DNA interactions phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 127.3)Signal transduction Two-component systems phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 127.3)and 7 moreproteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 72.6)Central intermediary metabolism Nitrogen metabolism nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 63.9)Regulatory functions DNA interactions nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 63.9)Signal transduction Two-component systems nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 63.9)Cellular processes Sporulation and germination sporulation transcription factor Spo0A (TIGR02875; HMM-score: 58.3)Signal transduction Two-component systems TMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 33.1)Regulatory functions DNA interactions PEP-CTERM-box response regulator transcription factor (TIGR02915; HMM-score: 31.8)
- TheSEED :
- Two-component system response regulator ArlR
- PFAM: CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 110)and 3 moreiREC; Inactive Receiver domain (PF22563; HMM-score: 18.3)GlnR_1st; Transcription regulator GlnR, N-terminal domain (PF21695; HMM-score: 14.8)PDE8A_N; PDE8A-like, N-terminal domain (PF23198; HMM-score: 14.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9875
- Cytoplasmic Membrane Score: 0.0027
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.0097
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.001435
- TAT(Tat/SPI): 0.000091
- LIPO(Sec/SPII): 0.000226
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MTQILIVEDEQNLARFLELELTHENYNVDTEYDGQDGLDKALSHYYDLIILDLMLPSINGLEICRKIRQQQSTPIIIITAKSDTYDKVAGLDYGADDYIVKPFDIEELLARIRAILRRQPQKDIIDVNGTLLK
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: arlS < SA1247 < SA1248
⊟Regulation[edit | edit source]
- regulator: Fur* (repression) regulon
Fur* (TF) important in Iron homeostasis; RegPrecise
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.