Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_RS02345 [old locus tag: NWMN_0416 ]
- pan locus tag?: SAUPAN002154000
- symbol: NWMN_RS02345
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_RS02345 [old locus tag: NWMN_0416 ]
- symbol: NWMN_RS02345
- product: hypothetical protein
- replicon: chromosome
- strand: -
- coordinates: 464009..464269
- length: 261
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241TTGAGCGCTTTACTTTATAATGGAGACAAAGATATATCTCACGAAAGAGAATCGAGGTGT
ATAAACATGTTATTTGTCATTTTAGTTTTATATGTTACTGGTATTGCATTTATTCTACTC
AGTGTTTTTGGTTCAAAGACTGAAGGATTATCTACGAAACATACTTTATATACCATTGGC
AGTGCTATTATAACGATTGCTATTTTCATTTCAATTGGCTATGCCATTCAATACTTAACT
GCAGCGCTTTATGGTTTGTAA60
120
180
240
261
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_RS02345 [old locus tag: NWMN_0416 ]
- symbol: NWMN_RS02345
- description: hypothetical protein
- length: 86
- theoretical pI: 7.50332
- theoretical MW: 9423.07
- GRAVY: 0.860465
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED: see NWMN_0416
- PFAM: no clan defined Herpes_US9; Alphaherpesvirus tegument protein US9 (PF06072; HMM-score: 17.6)GPCR_A (CL0192) Srg; Srg family chemoreceptor (PF02118; HMM-score: 16.1)no clan defined DUF1218; Protein of unknown function (DUF1218) (PF06749; HMM-score: 15.9)DUF6161; Family of unknown function (DUF6161) (PF19658; HMM-score: 15)and 4 moreABC-2 (CL0181) ABC2_membrane_5; ABC-2 family transporter protein (PF13346; HMM-score: 13.6)no clan defined DUF5337; Family of unknown function (DUF5337) (PF17272; HMM-score: 12.6)HILPDA; Hypoxia-inducible lipid droplet-associated (PF15220; HMM-score: 11.8)ABC-2 (CL0181) ABC2_membrane_3; ABC-2 family transporter protein (PF12698; HMM-score: 11.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.32
- Cytoplasmic Membrane Score: 9.55
- Cellwall Score: 0.12
- Extracellular Score: 0.01
- Internal Helices: 2
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.9191
- Cell wall & surface Score: 0
- Extracellular Score: 0.0808
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.005702
- TAT(Tat/SPI): 0.000201
- LIPO(Sec/SPII): 0.003421
- predicted transmembrane helices (TMHMM): 2
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MSALLYNGDKDISHERESRCINMLFVILVLYVTGIAFILLSVFGSKTEGLSTKHTLYTIGSAIITIAIFISIGYAIQYLTAALYGL
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- data available for JSNZ
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.