PangenomeCOLN315NCTC8325NewmanUSA300_FPR3757JSNZ04-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

FunGene: 08-OCT-2024

⊟Summary

• organism: Staphylococcus aureus JSNZ
• locus tag: JSNZ_002185
• pan locus tag^?: SAUPAN005671000
• symbol: JSNZ_002185
• pan gene symbol^?: cbiO2
• synonym: ecfA2
• product: energy-coupling factor transporter ATPase

⊟Genome View

⊟Gene

⊟General

• type: CDS
• locus tag: JSNZ_002185
• symbol: JSNZ_002185
• product: energy-coupling factor transporter ATPase
• replicon: chromosome
• strand: -
• coordinates: 2199939..2200799
• length: 861
• essential: unknown other strains

⊟Accession numbers

• Gene ID:
• RefSeq:
• BioCyc:
• MicrobesOnline:

⊟Phenotype

Share your knowledge and add information here. [edit]

⊟DNA sequence

• 1
  61
  121
  181
  241
  301
  361
  421
  481
  541
  601
  661
  721
  781
  841
  
  ATGACTATACGCTTTGACAATGTAAGTTATACCTATCAAAAAGGGACACCATACCAGCAT
  CAAGCTATTCATGATGTTAATACAGAATTTGAACAAGGTAAATATTACGCCATCGTTGGA
  CAAACAGGTAGTGGTAAATCAACATTGATACAAAATATTAATGCACTGTTAAAGCCAACT
  ACTGGGACAGTTACAGTTGATGACATTACTATTACACATAAGACCAAAGATAAATATATT
  AGACCTGTAAGAAAAAGAATTGGAATGGTATTTCAATTCCCCGAATCTCAATTATTTGAG
  GACACAGTAGAGCGTGAAATGATATTTGGACCTAAAAACTTTAAAATGAATTTAGATGAA
  GCTAAAAACTATGCCCATCGTCTGTTGATGGATTTAGGCTTTTCAAGAGATGTAATGTCA
  CAATCACCATTTCAAATGTCAGGTGGACAAATGCGTAAAATAGCGATTGTATCGATATTA
  GCAATGAATCCTGATATTATCGTGGTTGATGAACCTACAGCAGGACTTGATCCACAAAGT
  AAACGACAAGTAATGCGATTACTAAAGTCACTACAAATAGATGAAAATAAGGCAATTATC
  CTAATTTCACATGATATGAATGAAGTCGCGCGTTATGCAGATGAAGTCATCGTTATGAAA
  GAAGGTAGTATAGTGTCGCAAACATCACCAAAAGAGCTCTTCAAAGATAAAGAAAAATTG
  GCGGATTGGCATATTGGTTTGCCAGAAATTGTTCAGTTACAATATGACTTTGAACAAAAA
  CATCAAACAAAATTAAAAGATATTGCCTTAACTGAAGAAGCATTTGTAAGCTTGTATAAG
  GAGTGGCAACATGAAAAATAA
  60
  120
  180
  240
  300
  360
  420
  480
  540
  600
  660
  720
  780
  840
  861
  

⊟Protein

⊟General

• locus tag: JSNZ_002185
• symbol: JSNZ_002185
• description: energy-coupling factor transporter ATPase
• length: 286
• theoretical pI: 6.73456
• theoretical MW: 32905.6
• GRAVY: -0.448601

⊟Function

• reaction:
  EC 3.6.3.-?  ExPASy
• TIGRFAM:
  Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 367.1)
  and 80 more
  Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 255.7)
  Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 153.6)
  Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 151.7)
  Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 151.6)
  Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 143.6)
  Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 143.3)
  Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 139.9)
  D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 132)
  Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 131.6)
  Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 128.4)
  Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 128.4)
  Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 128)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 121.8)
  ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 121.4)
  Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 120.6)
  Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 119.5)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 119.5)
  Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 119)
  Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 118.6)
  thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 118)
  ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 116.9)
  Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 115.4)
  Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 115.4)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 113.8)
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 113.5)
  Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 109.4)
  ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 109)
  2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 106.2)
  Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 105.2)
  Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 105.2)
  Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 102.6)
  thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 101.8)
  Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 99.5)
  Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 97.9)
  Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 97.9)
  Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 96.5)
  Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 95.7)
  Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 94.8)
  Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 94.4)
  Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 93.6)
  Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 93.6)
  gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 93)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 91.4)
  Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 91.4)
  Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 91.4)
  Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 89.1)
  Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 89.1)
  proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 86.5)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 83.4)
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 82.5)
  Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 79.3)
  lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 77)
  phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 76.1)
  Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 75.1)
  Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 75.1)
  Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 73.5)
  Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 72)
  Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 71.9)
  Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 71.9)
  Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 67.9)
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 66.4)
  Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 64.2)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 56.2)
  Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 56.2)
  ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 50.4)
  Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 46.1)
  Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 42.1)
  Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 40.2)
  Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 35.7)
  Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA repair protein RecN (TIGR00634; HMM-score: 20.9)
  Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 19.3)
  Genetic information processing Protein fate Protein and peptide secretion and trafficking putative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 17.6)
  Genetic information processing Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 16.1)
  Cellular processes Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 15.4)
  helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 13.2)
  Genetic information processing Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 13)
  Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions dTMP kinase (TIGR00041; EC 2.7.4.9; HMM-score: 12.8)
  Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 12.5)
  Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 12)
  Genetic information processing Mobile and extrachromosomal element functions Plasmid functions plasmid transfer ATPase TraJ (TIGR02525; HMM-score: 11.5)
• TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
• PFAM:
  P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 101.5)
  and 30 more
  AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 47.4)
  SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 34.7)
  AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 28.8)
  AAA_15; AAA ATPase domain (PF13175; HMM-score: 25.6)
  RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 24.5)
  ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 22.1)
  AAA_22; AAA domain (PF13401; HMM-score: 21.2)
  DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 20.5)
  AAA_23; AAA domain (PF13476; HMM-score: 18.7)
  MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 18.2)
  Zeta_toxin; Zeta toxin (PF06414; HMM-score: 17.8)
  SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 16.7)
  Dynamin_N; Dynamin family (PF00350; HMM-score: 16.5)
  AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 15.8)
  T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 15.6)
  AAA_19; AAA domain (PF13245; HMM-score: 15.6)
  DUF87; Helicase HerA, central domain (PF01935; HMM-score: 15.5)
  nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 15.2)
  RNA_helicase; RNA helicase (PF00910; HMM-score: 14.3)
  NB-ARC; NB-ARC domain (PF00931; HMM-score: 14.2)
  ABC_ATPase; P-loop domain (PF09818; HMM-score: 14.2)
  AAA_16; AAA ATPase domain (PF13191; HMM-score: 14.2)
  NACHT; NACHT domain (PF05729; HMM-score: 14.1)
  AAA_30; AAA domain (PF13604; HMM-score: 14.1)
  AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 13.5)
  AAA_14; AAA domain (PF13173; HMM-score: 13.3)
  NTPase_1; NTPase (PF03266; HMM-score: 13.1)
  no clan defined Sua5_yciO_yrdC; Telomere recombination (PF01300; HMM-score: 12.8)
  P-loop_NTPase (CL0023) FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 12.7)
  Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 11.5)

⊟Structure, modifications & cofactors

• domains:
• modifications:
• cofactors:
• effectors:

⊟Localization

• PSORTb: Cytoplasmic Membrane
  • Cytoplasmic Score: 0.01
  • Cytoplasmic Membrane Score: 9.99
  • Cellwall Score: 0
  • Extracellular Score: 0
  • Internal Helices: 0
• DeepLocPro: Cytoplasmic Membrane
  • Cytoplasmic Score: 0.2672
  • Cytoplasmic Membrane Score: 0.7308
  • Cell wall & surface Score: 0.0007
  • Extracellular Score: 0.0013
• LocateP:
• SignalP: no predicted signal peptide
  • SP(Sec/SPI): 0.022611
  • TAT(Tat/SPI): 0.00035
  • LIPO(Sec/SPII): 0.001355
• predicted transmembrane helices (TMHMM): 0

⊟Accession numbers

• GI:
• RefSeq:
• UniProt:

⊟Protein sequence

• MTIRFDNVSYTYQKGTPYQHQAIHDVNTEFEQGKYYAIVGQTGSGKSTLIQNINALLKPTTGTVTVDDITITHKTKDKYIRPVRKRIGMVFQFPESQLFEDTVEREMIFGPKNFKMNLDEAKNYAHRLLMDLGFSRDVMSQSPFQMSGGQMRKIAIVSILAMNPDIIVVDEPTAGLDPQSKRQVMRLLKSLQIDENKAIILISHDMNEVARYADEVIVMKEGSIVSQTSPKELFKDKEKLADWHIGLPEIVQLQYDFEQKHQTKLKDIALTEEAFVSLYKEWQHEK

⊟Experimental data

• experimentally validated: data available for COL, NCTC8325
• protein localization: data available for COL
• quantitative data / protein copy number per cell:
• interaction partners:

⊟Expression & Regulation

⊟Operon

⊟Regulation

• regulator:

⊟Transcription pattern

• S.aureus Expression Data Browser: data available for NCTC8325

⊟Protein synthesis (provided by Aureolib)

• Aureolib: no data available

⊟Protein stability

• half-life: no data available

⊟Biological Material

⊟Mutants

⊟Expression vector

⊟lacZ fusion

⊟GFP fusion

⊟two-hybrid system

⊟FLAG-tag construct

⊟Antibody

⊟Other Information

You are kindly invited to share additional interesting facts.

⊟Literature

⊟References

⊟Relevant publications