From AureoWiki
Jump to navigation Jump to search

FunGene: 08-OCT-2024

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: JSNZ_000265
  • pan locus tag?: SAUPAN001234000
  • symbol: JSNZ_000265
  • pan gene symbol?:
  • synonym:
  • product: carbohydrate kinase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: JSNZ_000265
  • symbol: JSNZ_000265
  • product: carbohydrate kinase
  • replicon: chromosome
  • strand: +
  • coordinates: 299725..300843
  • length: 1119
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq:
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    ATGAGCGATTCTGAGAAAGAAATTTTAAAAAGAATTAAAGATAATCCGTTTATTTCACAA
    CGTGAACTTGCTGAGGCAATTGGATTATCTAGACCCAGCGTAGCAAACATTATTTCAGGA
    TTAATACAAAAGGAATATGTTATGGGAAAGGCATATGTTTTAAATGAAGATTATCCTATT
    GTTTGTATTGGCGCAGCGAATGTAGATCGTAAGTTTTATGTGCATAAAGATTTAGTTGCA
    GAAACATCAAATCCTGTAACGTCAACACGTTCTATTGGTGGCGTAGCAAGAAATATTGCT
    GAGAACTTAGGTAGGCTTGGCGAAACGGTCGCTTTTTTATCTGCTAGTGGACAAGATAGT
    GAATGGGAAATGATTAAACGATTGTCCACACCATTTATGAATTTGGATCATGTTCAACAA
    TTTGAAAATGCGAGTACAGGTTCATATACAGCTTTAATTAGTAAAGAAGGCGACATGACA
    TATGGCTTAGCAGATATGGAAGTGTTTGACTACATTACGCCTGAATTTTTAATTAAGCGT
    TCACACTTATTGAAAAAGGCTAAGTGCATTATTGTCGATTTGAATTTAGGCAAAGAGGCA
    TTAAGCTTCTTATGTGCCTATACCACGAAACATCAAATCAAATTAGTTATCACCACGGTT
    TCTTCCCCAAAAATGAAAAATATGCCTGATTCATTACATGCTATTGATTGGATTATCACG
    AATAAAGATGAAACAGAAACATACTTAAATTTAAAAATAGAATCTACTGATGATTTAAAA
    ATAGCTGCTAAACGCTGGAATGATTTAGGTGTTAAAAATGTTATTGTGACAAATGGCGTG
    AAAGAACTCATTTATCGAAGTGGTGAGGAAGAAATCATCAAGTCAGTTATGCCATCAAAT
    AGTGTGAAAGATGTTACAGGTGCAGGTGATTCATTCTGTGCTGCAGTAGTGTATAGCTGG
    TTAAATGGGATGTCTACTGAAGATATATTAATTGCTGGTATGGTTAACGCAAAGAAAACG
    ATAGAAACGAAATATACAGTTAGGCAAAACCTAGATCAACAGCAACTTTATCACGATATG
    GAGGATTATAAAAATGGCAAATTTACAAAAGTATATTGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1119

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: JSNZ_000265
  • symbol: JSNZ_000265
  • description: carbohydrate kinase
  • length: 372
  • theoretical pI: 6.01346
  • theoretical MW: 41642.4
  • GRAVY: -0.234946

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Energy metabolism Sugars ribokinase (TIGR02152; EC 2.7.1.15; HMM-score: 98.4)
    and 8 more
    Metabolism Energy metabolism Sugars 5-dehydro-2-deoxygluconokinase (TIGR04382; EC 2.7.1.92; HMM-score: 63)
    hexose kinase, 1-phosphofructokinase family (TIGR03168; EC 2.7.1.-; HMM-score: 60)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides bifunctional protein RfaE, domain I (TIGR02198; EC 2.7.1.-; HMM-score: 55.1)
    1-phosphofructokinase (TIGR03828; EC 2.7.1.56; HMM-score: 53)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase (TIGR00097; EC 2.7.1.49,2.7.4.7; HMM-score: 29)
    EPS-associated transcriptional regulator, MarR family (TIGR04176; HMM-score: 25.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pyridoxine pyridoxal kinase (TIGR00687; EC 2.7.1.35; HMM-score: 13.5)
    Signal transduction Regulatory functions DNA interactions CRISPR locus-related DNA-binding protein (TIGR01884; HMM-score: 12.8)
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    Ribokinase (CL0118) PfkB; pfkB family carbohydrate kinase (PF00294; HMM-score: 143.3)
    and 15 more
    HTH (CL0123) HTH_24; Winged helix-turn-helix DNA-binding (PF13412; HMM-score: 39.5)
    MarR; MarR family (PF01047; HMM-score: 27.2)
    Ribokinase (CL0118) Phos_pyr_kin; Phosphomethylpyrimidine kinase (PF08543; HMM-score: 26.4)
    HTH (CL0123) MarR_2; MarR family (PF12802; HMM-score: 24.2)
    HTH_36; Helix-turn-helix domain (PF13730; HMM-score: 21.4)
    HTH_3; Helix-turn-helix (PF01381; HMM-score: 20.9)
    HTH_AsnC-type; AsnC-type helix-turn-helix domain (PF13404; HMM-score: 20.1)
    HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 18.2)
    HTH_IclR; IclR helix-turn-helix domain (PF09339; HMM-score: 17.1)
    Fe_dep_repress; Iron dependent repressor, N-terminal DNA binding domain (PF01325; HMM-score: 15.4)
    TrmB; Sugar-specific transcriptional regulator TrmB (PF01978; HMM-score: 14.8)
    DnaD_N; DnaD N-terminal domain (PF21984; HMM-score: 14.6)
    HTH_11; HTH domain (PF08279; HMM-score: 13.3)
    Plasmid_toxin (CL0136) MqsR_toxin; Motility quorum-sensing regulator, toxin of MqsA (PF15723; HMM-score: 12.3)
    HTH (CL0123) YdaS_toxin; Bacterial toxin YdaS (PF15943; HMM-score: 12)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9862
    • Cytoplasmic Membrane Score: 0.0094
    • Cell wall & surface Score: 0.0003
    • Extracellular Score: 0.0041
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.006472
    • TAT(Tat/SPI): 0.002668
    • LIPO(Sec/SPII): 0.000742
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit | edit source]

  • MSDSEKEILKRIKDNPFISQRELAEAIGLSRPSVANIISGLIQKEYVMGKAYVLNEDYPIVCIGAANVDRKFYVHKDLVAETSNPVTSTRSIGGVARNIAENLGRLGETVAFLSASGQDSEWEMIKRLSTPFMNLDHVQQFENASTGSYTALISKEGDMTYGLADMEVFDYITPEFLIKRSHLLKKAKCIIVDLNLGKEALSFLCAYTTKHQIKLVITTVSSPKMKNMPDSLHAIDWIITNKDETETYLNLKIESTDDLKIAAKRWNDLGVKNVIVTNGVKELIYRSGEEEIIKSVMPSNSVKDVTGAGDSFCAAVVYSWLNGMSTEDILIAGMVNAKKTIETKYTVRQNLDQQQLYHDMEDYKNGKFTKVY

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
    Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
    Bioinformatics: 2018, 34(23);4118-4120
    [PubMed:29931111] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]