Jump to navigation
Jump to search
NCBI: 22-FEB-2026
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_RS05620 [old locus tag: EGJ38_001125 ]
- pan locus tag?: SAUPAN003405000
- symbol: scb
- pan gene symbol?: scc
- synonym:
- product: complement inhibitor SCIN-B
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: EGJ38_RS05620 [old locus tag: EGJ38_001125 ]
- symbol: scb
- product: complement inhibitor SCIN-B
- replicon: chromosome
- strand: +
- coordinates: 1127798..1128148
- length: 351
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NZ_CM129921 (1127798..1128148) NCBI
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301ATGAAATTTAAAAAATATATATTAACTGGAACATTAGCATTACTTTTATCATCAACTGCG
ATAGCAACTATAGAAGGAAATAAAGCAGATGCAAGTAGTCTGGACAAATATTTAACTGAA
AGTCAGTTTCATGATAAACGCATAGCAGAAGAATTAAGAACTTTACTTAACAAATCGAAT
GTATATGCATTAGCTGCAGGAAGCTTAAATCCATATTATAAACGTACGATTATGATGAAT
GAATATAGAGCTAAAGCGGCACTTAAGAAAAATGATTTCGTATCAATGGCTGATGCTAAA
GTTGCATTAGAAAAAATATACAAAGAAATTGATGAAATTATAAATAGATAA60
120
180
240
300
351
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_RS05620 [old locus tag: EGJ38_001125 ]
- symbol: Scb
- description: complement inhibitor SCIN-B
- length: 116
- theoretical pI: 9.86614
- theoretical MW: 13128.2
- GRAVY: -0.268966
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: no clan defined CompInhib_SCIN; Staphylococcal complement inhibitor SCIN (PF11546; HMM-score: 185.2)and 2 moreTPR (CL0020) M-HEAT_ATR; Serine/threonine-protein kinase ATR, M-HEAT region (PF25030; HMM-score: 15.8)AAA_lid (CL0671) AAA_lid_2; AAA lid domain (PF17863; HMM-score: 11.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 3.33
- Cellwall Score: 3.33
- Extracellular Score: 3.33
- Internal Helices: 0
- DeepLocPro: Extracellular
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.0032
- Cell wall & surface Score: 0.0225
- Extracellular Score: 0.9743
- LocateP:
- SignalP: Signal peptide SP(Sec/SPI) length 31 aa
- SP(Sec/SPI): 0.947828
- TAT(Tat/SPI): 0.001695
- LIPO(Sec/SPII): 0.037901
- Cleavage Site: CS pos: 31-32. ADA-SS. Pr: 0.6437
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq: WP_000669532 NCBI
- UniProt:
⊟Protein sequence[edit | edit source]
- MKFKKYILTGTLALLLSSTAIATIEGNKADASSLDKYLTESQFHDKRIAEELRTLLNKSNVYALAAGSLNPYYKRTIMMNEYRAKAALKKNDFVSMADAKVALEKIYKEIDEIINR
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: SaeR/JSNZ_000674 see EGJ38_001125
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]