From AureoWiki
Jump to navigation Jump to search

NCBI: 22-FEB-2026

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: EGJ38_RS01885 [old locus tag: EGJ38_000377 ]
  • pan locus tag?: SAUPAN002154000
  • symbol: EGJ38_RS01885
  • pan gene symbol?: —
  • synonym:
  • product: hypothetical protein

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: EGJ38_RS01885 [old locus tag: EGJ38_000377 ]
  • symbol: EGJ38_RS01885
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 409467..409727
  • length: 261
  • essential: unknown other strains

⊟Accession numbers[edit | edit source]

  • Location: NZ_CM129921 (409467..409727) NCBI
  • BioCyc:
  • MicrobesOnline:

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    TTGAGCGCTTTACTTTATAATGGAAACAAAGATATATCTCACGAAAGAGAATCGAGGTGT
    ATAAACATGCTATTTGTCATTTTAGTTTTATATATCATTGGTATTGCATTTATTCTACTC
    AGTGTTTTTGGTTCAAAGACTGAAGGATTATCTACGAAACATACATTATATACCATTGGT
    AGTGCTATTATAACGATTGCTATTTTCATTTCAATTGGCTATGCCATTCAATACTTAACT
    GCAGCGCTTTATGGTTTGTAA
    60
    120
    180
    240
    261


⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: EGJ38_RS01885 [old locus tag: EGJ38_000377 ]
  • symbol: EGJ38_RS01885
  • description: hypothetical protein
  • length: 86
  • theoretical pI: 8.44446
  • theoretical MW: 9448.16
  • GRAVY: 0.924419

⊟Function[edit | edit source]

  • TIGRFAM:
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    GPCR_A (CL0192) Srg; Srg family chemoreceptor (PF02118; HMM-score: 17.7)
    no clan defined DUF1218; Protein of unknown function (DUF1218) (PF06749; HMM-score: 15.6)
    Herpes_US9; Alphaherpesvirus tegument protein US9 (PF06072; HMM-score: 14.9)
    DUF6161; Family of unknown function (DUF6161) (PF19658; HMM-score: 14.8)
    and 5 more
    ABC-2 (CL0181) ABC2_membrane_5; ABC-2 family transporter protein (PF13346; HMM-score: 14)
    no clan defined HILPDA; Hypoxia-inducible lipid droplet-associated (PF15220; HMM-score: 12.1)
    ABC-2 (CL0181) ABC2_membrane_3; ABC-2 family transporter protein (PF12698; HMM-score: 11.4)
    no clan defined UstYa; Mycotoxin biosynthesis protein UstYa (PF11807; HMM-score: 11)
    DUF2207_C; Predicted membrane protein (DUF2207) C-terminal domain (PF20990; HMM-score: 10.3)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.32
    • Cytoplasmic Membrane Score: 9.55
    • Cellwall Score: 0.12
    • Extracellular Score: 0.01
    • Internal Helices: 2
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.9316
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0684
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.00545
    • TAT(Tat/SPI): 0.000184
    • LIPO(Sec/SPII): 0.003153
  • predicted transmembrane helices (TMHMM): 2

⊟Accession numbers[edit | edit source]

  • GI:
  • RefSeq: WP_072398156 NCBI
  • UniProt:

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MSALLYNGNKDISHERESRCINMLFVILVLYIIGIAFILLSVFGSKTEGLSTKHTLYTIGSAIITIAIFISIGYAIQYLTAALYGL

⊟Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]


⊟Relevant publications[edit | edit source]

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=EGJ38_RS01885&oldid=117005"