From AureoWiki
Jump to navigation Jump to search

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1451 [new locus tag: SACOL_RS07400 ]
  • symbol: arlR
  • product: DNA-binding response regulator ArlR
  • replicon: chromosome
  • strand: -
  • coordinates: 1465407..1466066
  • length: 660
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGACGCAAATTTTAATAGTAGAAGATGAACAAAACTTAGCAAGATTTCTTGAATTGGAA
    CTCACACATGAAAATTACAATGTGGACACAGAGTATGATGGACAAGACGGTTTAGATAAA
    GCGCTTAGCCATTACTATGATTTAATCATATTAGATTTAATGTTGCCGTCAATTAATGGC
    TTAGAAATTTGTCGCAAAATTAGACAACAACAATCTACACCTATCATTATAATTACAGCG
    AAAAGTGATACGTATGACAAAGTTGCTGGGCTTGATTACGGTGCAGACGATTATATAGTT
    AAGCCGTTTGATATTGAAGAACTTTTAGCAAGAATTCGTGCAATTTTACGTCGTCAGCCA
    CAAAAGGATATTATCGATGTCAACGGTATTACAATTGATAAGAACGCTTTTAAAGTGACG
    GTAAATGGCGCAGAAATTGAATTAACAAAAACAGAGTATGATTTACTATATCTTCTAGCT
    GAAAATAAAAACCATGTTATGCAACGGGAACAAATTTTAAATCATGTATGGGGTTATAAT
    AGTGAAGTAGAAACAAATGTCGTAGATGTTTATATAAGATATTTACGAAACAAGTTAAAA
    CCATACGATCGTGACAAAATGATTGAAACAGTTCGTGGCGTTGGGTATGTGATACGATGA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1451 [new locus tag: SACOL_RS07400 ]
  • symbol: ArlR
  • description: DNA-binding response regulator ArlR
  • length: 219
  • theoretical pI: 4.63339
  • theoretical MW: 25497.9
  • GRAVY: -0.331507

Function[edit | edit source]

  • TIGRFAM:
    Signal transduction Regulatory functions DNA interactions phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 226.4)
    Signal transduction Signal transduction Two-component systems phosphate regulon transcriptional regulatory protein PhoB (TIGR02154; HMM-score: 226.4)
    Signal transduction Regulatory functions DNA interactions heavy metal response regulator (TIGR01387; HMM-score: 221)
    and 8 more
    proteobacterial dedicated sortase system response regulator (TIGR03787; HMM-score: 113.5)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 62.2)
    Signal transduction Regulatory functions DNA interactions nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 62.2)
    Signal transduction Signal transduction Two-component systems nitrogen regulation protein NR(I) (TIGR01818; HMM-score: 62.2)
    Cellular processes Cellular processes Sporulation and germination sporulation transcription factor Spo0A (TIGR02875; HMM-score: 57.7)
    Signal transduction Signal transduction Two-component systems TMAO reductase sytem sensor TorS (TIGR02956; EC 2.7.13.3; HMM-score: 32.6)
    Signal transduction Regulatory functions DNA interactions PEP-CTERM-box response regulator transcription factor (TIGR02915; HMM-score: 31)
    Genetic information processing Mobile and extrachromosomal element functions Prophage functions putative phage terminase, small subunit, P27 family (TIGR01558; HMM-score: 13)
  • TheSEED  :
    • Two-component system response regulator ArlR
  • PFAM:
    CheY (CL0304) Response_reg; Response regulator receiver domain (PF00072; HMM-score: 108.9)
    HTH (CL0123) Trans_reg_C; Transcriptional regulatory protein, C terminal (PF00486; HMM-score: 100.4)
    and 4 more
    E-set (CL0159) Glucodextran_B; Glucodextranase, domain B (PF09136; HMM-score: 17.4)
    CheY (CL0304) iREC; Inactive Receiver domain (PF22563; HMM-score: 17)
    GlnR_1st; Transcription regulator GlnR, N-terminal domain (PF21695; HMM-score: 13.3)
    PDE8A_N; PDE8A-like, N-terminal domain (PF23198; HMM-score: 13.2)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.991
    • Cytoplasmic Membrane Score: 0.0015
    • Cell wall & surface Score: 0.0002
    • Extracellular Score: 0.0073
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.001435
    • TAT(Tat/SPI): 0.000091
    • LIPO(Sec/SPII): 0.000226
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTQILIVEDEQNLARFLELELTHENYNVDTEYDGQDGLDKALSHYYDLIILDLMLPSINGLEICRKIRQQQSTPIIIITAKSDTYDKVAGLDYGADDYIVKPFDIEELLARIRAILRRQPQKDIIDVNGITIDKNAFKVTVNGAEIELTKTEYDLLYLLAENKNHVMQREQILNHVWGYNSEVETNVVDVYIRYLRNKLKPYDRDKMIETVRGVGYVIR

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3]
  • quantitative data / protein copy number per cell: 139 [4]
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 14.42 h [5]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  5. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]

Stefan Meier, Christiane Goerke, Christiane Wolz, Kati Seidl, Dagmar Homerova, Bettina Schulthess, Jan Kormanec, Brigitte Berger-Bächi, Markus Bischoff
sigmaB and the sigmaB-dependent arlRS and yabJ-spoVG loci affect capsule formation in Staphylococcus aureus.
Infect Immun: 2007, 75(9);4562-71
[PubMed:17635871] [WorldCat.org] [DOI] (P p)
Guido Memmi, Dhanalakshmi R Nair, Ambrose Cheung
Role of ArlRS in autolysis in methicillin-sensitive and methicillin-resistant Staphylococcus aureus strains.
J Bacteriol: 2012, 194(4);759-67
[PubMed:22139508] [WorldCat.org] [DOI] (I p)