From AureoWiki
Revision as of 08:46, 11 March 2016 by AureoSysAdmin (talk | contribs) (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL2368 [new locus tag: SACOL_RS12435 ]
  • symbol: SACOL2368
  • product: acetyltransferase
  • replicon: chromosome
  • strand: -
  • coordinates: 2428786..2429187
  • length: 402
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    ATGGTTAAAGTGACATATGATATTCCGACTTGCGAGGATTATTGCGCATTAAGGATTAAC
    GCAGGTATGAGTCCAAAGACGCGCGAAGCAGCTGAAAAAGGATTACCTAATGCCTTATTT
    ACAGTAACCTTGTATGATAAAGATCGGTTAATTGGTATGGGTAGAGTGATTGGCGATGGC
    GGAACTGTTTTTCAAATTGTTGATATTGCAGTTTTGAAAAGTTACCAAGGTCAAGGTTAC
    GGCAGTCTAATTATGGAGCATATTATGCAATATATTAAAGGTGTGGCTGTTGAGAGTACA
    TACGTTAGTCTGATTGCAGACTACCCAGCGGATAAATTATATACAAAATTTGGATTTATA
    CCTACCGAACCAGATTCAGGCGGTATGTATATCAAATACTAA
    60
    120
    180
    240
    300
    360
    402

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL2368 [new locus tag: SACOL_RS12435 ]
  • symbol: SACOL2368
  • description: acetyltransferase
  • length: 133
  • theoretical pI: 5.1296
  • theoretical MW: 14682.9
  • GRAVY: 0.0270677

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis Ribosomal proteins: synthesis and modification ribosomal-protein-alanine acetyltransferase (TIGR01575; EC 2.3.1.128; HMM-score: 30.9)
  • TheSEED  :
    • Attachment to host cells and virulence
  • PFAM:
    Acetyltrans (CL0257) Acetyltransf_1; Acetyltransferase (GNAT) family (PF00583; HMM-score: 49.9)
    Acetyltransf_7; Acetyltransferase (GNAT) domain (PF13508; HMM-score: 48.9)
    Acetyltransf_10; Acetyltransferase (GNAT) domain (PF13673; HMM-score: 45.8)
    and 5 more
    FR47; FR47-like protein (PF08445; HMM-score: 23.4)
    GNAT_acetyltr_2; GNAT acetyltransferase 2 (PF13718; HMM-score: 20.2)
    Acetyltransf_9; Acetyltransferase (GNAT) domain (PF13527; HMM-score: 16.5)
    IDM1_C; Increased DNA methylation 1, C-terminal (PF23209; HMM-score: 14.3)
    Acetyltransf_CG; GCN5-related N-acetyl-transferase (PF14542; HMM-score: 13.5)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9085
    • Cytoplasmic Membrane Score: 0.0021
    • Cell wall & surface Score: 0.0002
    • Extracellular Score: 0.0893
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.011018
    • TAT(Tat/SPI): 0.000215
    • LIPO(Sec/SPII): 0.001369
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MVKVTYDIPTCEDYCALRINAGMSPKTREAAEKGLPNALFTVTLYDKDRLIGMGRVIGDGGTVFQIVDIAVLKSYQGQGYGSLIMEHIMQYIKGVAVESTYVSLIADYPADKLYTKFGFIPTEPDSGGMYIKY

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2]
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]