Jump to navigation
Jump to search
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_RS06090 [old locus tag: SAUSA300_1125 ]
- pan locus tag?: SAUPAN003519000
- symbol: SAUSA300_RS06090
- pan gene symbol?: acpP
- synonym: JSNZ_001201
- product: acyl carrier protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAUSA300_RS06090 [old locus tag: SAUSA300_1125 ]
- symbol: SAUSA300_RS06090
- product: acyl carrier protein
- replicon: chromosome
- strand: +
- coordinates: 1231491..1231724
- length: 234
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Location: NC_007793 (1231491..1231724) NCBI
- BioCyc: SAUSA300_RS06090 BioCyc
- MicrobesOnline: see SAUSA300_1125
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181GTGGAAAATTTCGATAAAGTAAAAGATATCATCGTTGACCGTTTAGGTGTAGACGCTGAT
AAAGTAACTGAAGATGCATCTTTCAAAGATGATTTAGGCGCTGACTCACTTGATATCGCT
GAATTAGTAATGGAATTAGAAGACGAGTTTGGTACTGAAATTCCTGATGAAGAAGCTGAA
AAAATCAACACTGTTGGTGATGCTGTTAAATTTATTAACAGTCTTGAAAAATAA60
120
180
234
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_RS06090 [old locus tag: SAUSA300_1125 ]
- symbol: SAUSA300_RS06090
- description: acyl carrier protein
- length: 77
- theoretical pI: 3.72176
- theoretical MW: 8549.37
- GRAVY: -0.376623
⊟Function[edit | edit source]
- TIGRFAM: Fatty acid and phospholipid metabolism Biosynthesis acyl carrier protein (TIGR00517; HMM-score: 109.8)and 1 moreCellular processes Toxin production and resistance peptide maturation system acyl carrier-related protein (TIGR04069; HMM-score: 17.9)
- TheSEED: see SAUSA300_1125
- PFAM: PP-binding (CL0314) PP-binding; Phosphopantetheine attachment site (PF00550; HMM-score: 61.4)and 4 moreDUF7080; Domain of unknown function (DUF7080) (PF23297; HMM-score: 17.5)PP-binding_2; Acyl-carrier (PF14573; HMM-score: 16.4)Ribosomal_L50; Ribosomal subunit 39S (PF10501; HMM-score: 14.9)no clan defined Ribosomal_L12_N; Ribosomal protein L7/L12 dimerisation domain (PF16320; HMM-score: 13.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9868
- Cytoplasmic Membrane Score: 0.0009
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.0121
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.003188
- TAT(Tat/SPI): 0.000506
- LIPO(Sec/SPII): 0.00048
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI: 446349059 NCBI
- RefSeq: WP_000426914 NCBI
- UniProt: see SAUSA300_1125
⊟Protein sequence[edit | edit source]
- MENFDKVKDIIVDRLGVDADKVTEDASFKDDLGADSLDIAELVMELEDEFGTEIPDEEAEKINTVGDAVKFINSLEK
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SAUSA300_RS04775 beta-ketoacyl-[acyl-carrier-protein] synthase II [1] (data from MRSA252) SAUSA300_RS06770 4-hydroxybenzoyl-CoA thioesterase [1] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ 1.0 1.1 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)