From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_T00056
  • pan locus tag?: SAUPAN004805000
  • symbol: SAOUHSC_T00056
  • pan gene symbol?: trnaW
  • synonym:
  • product: tRNA-Trp

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: tRNA
  • locus tag: SAOUHSC_T00056
  • symbol: SAOUHSC_T00056
  • product: tRNA-Trp
  • replicon: chromosome
  • strand: -
  • coordinates: 1899524..1899597
  • length: 74
  • essential: unknown

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    AGGGGCATAGTTCAACGGTAGAATAGAGGTCTCCAAAACCTTTGGTGTGGGTTCGATTCC
    TACTGCCCCTGCCA
    60
    74

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAOUHSC_T00056
  • symbol: SAOUHSC_T00056
  • description: tRNA-Trp
  • length:
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb:
  • DeepLocPro:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:
  • STRING:

Protein sequence[edit | edit source]

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here.

Literature[edit | edit source]

References[edit | edit source]

  1. Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]