From AureoWiki
Jump to navigation Jump to search

NCBI: 03-AUG-2016

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: SAOUHSC_00947
  • pan locus tag?: SAUPAN003184000
  • symbol: SAOUHSC_00947
  • pan gene symbol?: fabI
  • synonym:
  • product: enoyl-(acyl carrier protein) reductase

⊟Additional information (user-provided)[edit | edit source]

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SAOUHSC_00947
  • symbol: SAOUHSC_00947
  • product: enoyl-(acyl carrier protein) reductase
  • replicon: chromosome
  • strand: +
  • coordinates: 920031..920801
  • length: 771
  • essential: yes [1] DEG other strains

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGTTAAATCTTGAAAACAAAACATATGTCATCATGGGAATCGCTAATAAGCGTAGTATT
    GCTTTTGGTGTCGCTAAAGTTTTAGATCAATTAGGTGCTAAATTAGTATTTACTTACCGT
    AAAGAACGTAGCCGTAAAGAGCTTGAAAAATTATTAGAACAATTAAATCAACCAGAAGCG
    CACTTATATCAAATTGATGTTCAAAGCGATGAAGAGGTTATTAATGGTTTTGAGCAAATT
    GGTAAAGATGTTGGCAATATTGATGGTGTATATCATTCAATCGCATTTGCTAATATGGAA
    GACTTACGCGGACGCTTTTCTGAAACTTCACGTGAAGGCTTCTTGTTAGCTCAAGACATT
    AGTTCTTACTCATTAACAATTGTGGCTCATGAAGCTAAAAAATTAATGCCAGAAGGTGGT
    AGCATTGTTGCAACAACATATTTAGGTGGCGAATTCGCAGTTCAAAACTATAATGTGATG
    GGTGTTGCTAAAGCGAGCTTAGAAGCAAATGTTAAATATTTAGCATTAGACTTAGGTCCA
    GATAATATTCGCGTTAATGCAATTTCAGCTAGTCCAATCCGTACATTAAGTGCAAAAGGT
    GTGGGTGGTTTCAATACAATTCTTAAAGAAATCGAAGAGCGTGCACCTTTAAAACGTAAT
    GTTGATCAAGTAGAAGTAGGTAAAACTGCGGCTTACTTATTAAGTGATTTATCAAGTGGC
    GTTACAGGTGAAAATATTCATGTAGATAGCGGATTCCACGCAATTAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    771


⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAOUHSC_00947
  • symbol: SAOUHSC_00947
  • description: enoyl-(acyl carrier protein) reductase
  • length: 256
  • theoretical pI: 5.70808
  • theoretical MW: 28021.7
  • GRAVY: -0.144922

⊟Function[edit | edit source]

  • reaction:
    EC 1.3.1.10?  ExPASy
    Enoyl-[acyl-carrier-protein] reductase (NADPH, Si-specific) An acyl-[acyl-carrier protein] + NADP+ = a trans-2,3-dehydroacyl-[acyl-carrier protein] + NADPH
    EC 1.3.1.39?  ExPASy
    Enoyl-[acyl-carrier-protein] reductase (NADPH, Re-specific) An acyl-[acyl-carrier protein] + NADP+ = a trans-2,3-dehydroacyl-[acyl-carrier protein] + NADPH
  • TIGRFAM:
    Metabolism Fatty acid and phospholipid metabolism Biosynthesis 3-oxoacyl-[acyl-carrier-protein] reductase (TIGR01830; EC 1.1.1.100; HMM-score: 63.5)
    Unknown function Enzymes of unknown specificity SDR family mycofactocin-dependent oxidoreductase (TIGR03971; EC 1.1.99.-; HMM-score: 58.6)
    rhamnulose-1-phosphate aldolase/alcohol dehydrogenase (TIGR02632; EC 1.1.1.1,4.1.2.19; HMM-score: 51.8)
    and 8 more
    acetoacetyl-CoA reductase (TIGR01829; EC 1.1.1.36; HMM-score: 47.8)
    Metabolism Energy metabolism Biosynthesis and degradation of polysaccharides 2-deoxy-D-gluconate 3-dehydrogenase (TIGR01832; EC 1.1.1.125; HMM-score: 39.8)
    3-hydroxybutyrate dehydrogenase (TIGR01963; HMM-score: 39.5)
    Unknown function Enzymes of unknown specificity SDR family mycofactocin-dependent oxidoreductase (TIGR04504; EC 1.1.99.-; HMM-score: 38.2)
    2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (TIGR04316; EC 1.3.1.28; HMM-score: 38)
    Metabolism Energy metabolism Fermentation acetoin reductases (TIGR02415; EC 1.1.1.-; HMM-score: 33)
    Metabolism Fatty acid and phospholipid metabolism Biosynthesis putative 3-oxoacyl-(acyl-carrier-protein) reductase (TIGR01831; HMM-score: 31.1)
    pteridine reductase (TIGR02685; EC 1.5.1.33; HMM-score: 30.8)
  • TheSEED  :
    • Enoyl-[acyl-carrier-protein] reductase [NADH] (EC 1.3.1.9)
    Fatty Acids, Lipids, and Isoprenoids Fatty acids Fatty Acid Biosynthesis FASII  Enoyl-[acyl-carrier-protein] reductase [NADH] (EC 1.3.1.9)
  • PFAM:
    NADP_Rossmann (CL0063) adh_short_C2; Enoyl-(Acyl carrier protein) reductase (PF13561; HMM-score: 277.9)
    and 3 more
    adh_short; short chain dehydrogenase (PF00106; HMM-score: 65.8)
    KR; KR domain (PF08659; HMM-score: 22.9)
    SDR; SDR-like rossmann domain (PF23441; HMM-score: 15.9)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 1.05
    • Cytoplasmic Membrane Score: 8.78
    • Cellwall Score: 0.08
    • Extracellular Score: 0.09
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.5284
    • Cytoplasmic Membrane Score: 0.3729
    • Cell wall & surface Score: 0.001
    • Extracellular Score: 0.0977
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.002447
    • TAT(Tat/SPI): 0.000352
    • LIPO(Sec/SPII): 0.0005
  • predicted transmembrane helices (TMHMM): 0

⊟Accession numbers[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MLNLENKTYVIMGIANKRSIAFGVAKVLDQLGAKLVFTYRKERSRKELEKLLEQLNQPEAHLYQIDVQSDEEVINGFEQIGKDVGNIDGVYHSIAFANMEDLRGRFSETSREGFLLAQDISSYSLTIVAHEAKKLMPEGGSIVATTYLGGEFAVQNYNVMGVAKASLEANVKYLALDLGPDNIRVNAISASPIRTLSAKGVGGFNTILKEIEERAPLKRNVDQVEVGKTAAYLLSDLSSGVTGENIHVDSGFHAIK

⊟Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas [2] [3]
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SAOUHSC_00524(rpoB)DNA-directed RNA polymerase subunit beta  [4] (data from MRSA252)
    SAOUHSC_00679hypothetical protein  [4] (data from MRSA252)
    SAOUHSC_02860HMG-CoA synthase  [4] (data from MRSA252)

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator: FapR* (repression) regulon
    FapR*(TF)important in Fatty acid biosynthesis; RegPrecise 

⊟Additional information (user-provided)[edit | edit source]

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Additional information (user-provided)[edit | edit source]

⊟Other information (user-provided)[edit | edit source]

You can add further information about the gene and protein here. [edit]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Roy R Chaudhuri, Andrew G Allen, Paul J Owen, Gil Shalom, Karl Stone, Marcus Harrison, Timothy A Burgis, Michael Lockyer, Jorge Garcia-Lara, Simon J Foster, Stephen J Pleasance, Sarah E Peters, Duncan J Maskell, Ian G Charles
    Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH).
    BMC Genomics: 2009, 10;291
    [PubMed:19570206] [WorldCat.org] [DOI] (I e)
  2. ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
    A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
    Proteomics: 2015, 15(21);3648-61
    [PubMed:26224020] [WorldCat.org] [DOI] (I p)
  3. ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
    A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
    Sci Rep: 2017, 7(1);9718
    [PubMed:28887440] [WorldCat.org] [DOI] (I e)
  4. ↑ 4.0 4.1 4.2 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  5. ↑ 5.0 5.1 5.2 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]

D A Heerding, G Chan, W E DeWolf, A P Fosberry, C A Janson, D D Jaworski, E McManus, W H Miller, T D Moore, D J Payne, X Qiu, S F Rittenhouse, C Slater-Radosti, W Smith, D T Takata, K S Vaidya, C C Yuan, W F Huffman
1,4-Disubstituted imidazoles are potential antibacterial agents functioning as inhibitors of enoyl acyl carrier protein reductase (FabI).
Bioorg Med Chem Lett: 2001, 11(16);2061-5
[PubMed:11514139] [WorldCat.org] [DOI] (P p)
William H Miller, Mark A Seefeld, Kenneth A Newlander, Irene N Uzinskas, Walter J Burgess, Dirk A Heerding, Catherine C K Yuan, Martha S Head, David J Payne, Stephen F Rittenhouse, Terrance D Moore, Stewart C Pearson, Valerie Berry, Walter E DeWolf, Paul M Keller, Brian J Polizzi, Xiayang Qiu, Cheryl A Janson, William F Huffman
Discovery of aminopyridine-based inhibitors of bacterial enoyl-ACP reductase (FabI).
J Med Chem: 2002, 45(15);3246-56
[PubMed:12109908] [WorldCat.org] [DOI] (P p)
Mark A Seefeld, William H Miller, Kenneth A Newlander, Walter J Burgess, Walter E DeWolf, Patricia A Elkins, Martha S Head, Dalia R Jakas, Cheryl A Janson, Paul M Keller, Peter J Manley, Terrance D Moore, David J Payne, Stewart Pearson, Brian J Polizzi, Xiayang Qiu, Stephen F Rittenhouse, Irene N Uzinskas, Nicola G Wallis, William F Huffman
Indole naphthyridinones as inhibitors of bacterial enoyl-ACP reductases FabI and FabK.
J Med Chem: 2003, 46(9);1627-35
[PubMed:12699381] [WorldCat.org] [DOI] (P p)
Hua Xu, Todd J Sullivan, Jun-ichiro Sekiguchi, Teruo Kirikae, Iwao Ojima, Christopher F Stratton, Weimin Mao, Fernando L Rock, M R K Alley, Francis Johnson, Stephen G Walker, Peter J Tonge
Mechanism and inhibition of saFabI, the enoyl reductase from Staphylococcus aureus.
Biochemistry: 2008, 47(14);4228-36
[PubMed:18335995] [WorldCat.org] [DOI] (P p)