⊟Summary[edit | edit source]
- organism: Staphylococcus aureus NCTC8325
- locus tag: SAOUHSC_00947
- pan locus tag?: SAUPAN003184000
- symbol: SAOUHSC_00947
- pan gene symbol?: fabI
- synonym:
- product: enoyl-(acyl carrier protein) reductase
⊟Additional information (user-provided)[edit | edit source]
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SAOUHSC_00947
- symbol: SAOUHSC_00947
- product: enoyl-(acyl carrier protein) reductase
- replicon: chromosome
- strand: +
- coordinates: 920031..920801
- length: 771
- essential: yes [1] DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3920658 NCBI
- RefSeq: YP_499500 NCBI
- BioCyc: G1I0R-889 BioCyc
- MicrobesOnline: 1289411 MicrobesOnline
⊟Phenotype[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721ATGTTAAATCTTGAAAACAAAACATATGTCATCATGGGAATCGCTAATAAGCGTAGTATT
GCTTTTGGTGTCGCTAAAGTTTTAGATCAATTAGGTGCTAAATTAGTATTTACTTACCGT
AAAGAACGTAGCCGTAAAGAGCTTGAAAAATTATTAGAACAATTAAATCAACCAGAAGCG
CACTTATATCAAATTGATGTTCAAAGCGATGAAGAGGTTATTAATGGTTTTGAGCAAATT
GGTAAAGATGTTGGCAATATTGATGGTGTATATCATTCAATCGCATTTGCTAATATGGAA
GACTTACGCGGACGCTTTTCTGAAACTTCACGTGAAGGCTTCTTGTTAGCTCAAGACATT
AGTTCTTACTCATTAACAATTGTGGCTCATGAAGCTAAAAAATTAATGCCAGAAGGTGGT
AGCATTGTTGCAACAACATATTTAGGTGGCGAATTCGCAGTTCAAAACTATAATGTGATG
GGTGTTGCTAAAGCGAGCTTAGAAGCAAATGTTAAATATTTAGCATTAGACTTAGGTCCA
GATAATATTCGCGTTAATGCAATTTCAGCTAGTCCAATCCGTACATTAAGTGCAAAAGGT
GTGGGTGGTTTCAATACAATTCTTAAAGAAATCGAAGAGCGTGCACCTTTAAAACGTAAT
GTTGATCAAGTAGAAGTAGGTAAAACTGCGGCTTACTTATTAAGTGATTTATCAAGTGGC
GTTACAGGTGAAAATATTCATGTAGATAGCGGATTCCACGCAATTAAATAA60
120
180
240
300
360
420
480
540
600
660
720
771
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAOUHSC_00947
- symbol: SAOUHSC_00947
- description: enoyl-(acyl carrier protein) reductase
- length: 256
- theoretical pI: 5.70808
- theoretical MW: 28021.7
- GRAVY: -0.144922
⊟Function[edit | edit source]
- reaction: EC 1.3.1.10? ExPASyEnoyl-[acyl-carrier-protein] reductase (NADPH, Si-specific) An acyl-[acyl-carrier protein] + NADP+ = a trans-2,3-dehydroacyl-[acyl-carrier protein] + NADPHEC 1.3.1.39? ExPASyEnoyl-[acyl-carrier-protein] reductase (NADPH, Re-specific) An acyl-[acyl-carrier protein] + NADP+ = a trans-2,3-dehydroacyl-[acyl-carrier protein] + NADPH
- TIGRFAM: Fatty acid and phospholipid metabolism Biosynthesis 3-oxoacyl-[acyl-carrier-protein] reductase (TIGR01830; EC 1.1.1.100; HMM-score: 63.5)Unknown function Enzymes of unknown specificity SDR family mycofactocin-dependent oxidoreductase (TIGR03971; EC 1.1.99.-; HMM-score: 58.6)rhamnulose-1-phosphate aldolase/alcohol dehydrogenase (TIGR02632; EC 1.1.1.1,4.1.2.19; HMM-score: 51.8)and 8 moreacetoacetyl-CoA reductase (TIGR01829; EC 1.1.1.36; HMM-score: 47.8)Energy metabolism Biosynthesis and degradation of polysaccharides 2-deoxy-D-gluconate 3-dehydrogenase (TIGR01832; EC 1.1.1.125; HMM-score: 39.8)3-hydroxybutyrate dehydrogenase (TIGR01963; HMM-score: 39.5)Unknown function Enzymes of unknown specificity SDR family mycofactocin-dependent oxidoreductase (TIGR04504; EC 1.1.99.-; HMM-score: 38.2)2,3-dihydro-2,3-dihydroxybenzoate dehydrogenase (TIGR04316; EC 1.3.1.28; HMM-score: 38)Energy metabolism Fermentation acetoin reductases (TIGR02415; EC 1.1.1.-; HMM-score: 33)Fatty acid and phospholipid metabolism Biosynthesis putative 3-oxoacyl-(acyl-carrier-protein) reductase (TIGR01831; HMM-score: 31.1)pteridine reductase (TIGR02685; EC 1.5.1.33; HMM-score: 30.8)
- TheSEED :
- Enoyl-[acyl-carrier-protein] reductase [NADH] (EC 1.3.1.9)
- PFAM: NADP_Rossmann (CL0063) adh_short_C2; Enoyl-(Acyl carrier protein) reductase (PF13561; HMM-score: 277.9)and 3 moreadh_short; short chain dehydrogenase (PF00106; HMM-score: 65.8)KR; KR domain (PF08659; HMM-score: 22.9)SDR; SDR-like rossmann domain (PF23441; HMM-score: 15.9)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 1.05
- Cytoplasmic Membrane Score: 8.78
- Cellwall Score: 0.08
- Extracellular Score: 0.09
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.5284
- Cytoplasmic Membrane Score: 0.3729
- Cell wall & surface Score: 0.001
- Extracellular Score: 0.0977
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.002447
- TAT(Tat/SPI): 0.000352
- LIPO(Sec/SPII): 0.0005
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Protein sequence[edit | edit source]
- MLNLENKTYVIMGIANKRSIAFGVAKVLDQLGAKLVFTYRKERSRKELEKLLEQLNQPEAHLYQIDVQSDEEVINGFEQIGKDVGNIDGVYHSIAFANMEDLRGRFSETSREGFLLAQDISSYSLTIVAHEAKKLMPEGGSIVATTYLGGEFAVQNYNVMGVAKASLEANVKYLALDLGPDNIRVNAISASPIRTLSAKGVGGFNTILKEIEERAPLKRNVDQVEVGKTAAYLLSDLSSGVTGENIHVDSGFHAIK
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas [2] [3]
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SAOUHSC_00524 (rpoB) DNA-directed RNA polymerase subunit beta [4] (data from MRSA252) SAOUHSC_00679 hypothetical protein [4] (data from MRSA252) SAOUHSC_02860 HMG-CoA synthase [4] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- predicted SigA promoter [5] : SAOUHSC_00941 > SAOUHSC_00942 > ppnK > SAOUHSC_00944 > SAOUHSC_00945 > SAOUHSC_00946 > S392 > S393 > SAOUHSC_00947
⊟Regulation[edit | edit source]
- regulator: FapR* (repression) regulon
FapR* (TF) important in Fatty acid biosynthesis; RegPrecise
⊟Additional information (user-provided)[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: [5]
Multi-gene expression profiles
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Additional information (user-provided)[edit | edit source]
⊟Other information (user-provided)[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Roy R Chaudhuri, Andrew G Allen, Paul J Owen, Gil Shalom, Karl Stone, Marcus Harrison, Timothy A Burgis, Michael Lockyer, Jorge Garcia-Lara, Simon J Foster, Stephen J Pleasance, Sarah E Peters, Duncan J Maskell, Ian G Charles
Comprehensive identification of essential Staphylococcus aureus genes using Transposon-Mediated Differential Hybridisation (TMDH).
BMC Genomics: 2009, 10;291
[PubMed:19570206] [WorldCat.org] [DOI] (I e) - ↑ Maren Depke, Stephan Michalik, Alexander Rabe, Kristin Surmann, Lars Brinkmann, Nico Jehmlich, Jörg Bernhardt, Michael Hecker, Bernd Wollscheid, Zhi Sun, Robert L Moritz, Uwe Völker, Frank Schmidt
A peptide resource for the analysis of Staphylococcus aureus in host-pathogen interaction studies.
Proteomics: 2015, 15(21);3648-61
[PubMed:26224020] [WorldCat.org] [DOI] (I p) - ↑ Stephan Michalik, Maren Depke, Annette Murr, Manuela Gesell Salazar, Ulrike Kusebauch, Zhi Sun, Tanja C Meyer, Kristin Surmann, Henrike Pförtner, Petra Hildebrandt, Stefan Weiss, Laura Marcela Palma Medina, Melanie Gutjahr, Elke Hammer, Dörte Becher, Thomas Pribyl, Sven Hammerschmidt, Eric W Deutsch, Samuel L Bader, Michael Hecker, Robert L Moritz, Ulrike Mäder, Uwe Völker, Frank Schmidt
A global Staphylococcus aureus proteome resource applied to the in vivo characterization of host-pathogen interactions.
Sci Rep: 2017, 7(1);9718
[PubMed:28887440] [WorldCat.org] [DOI] (I e) - ↑ 4.0 4.1 4.2 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p) - ↑ 5.0 5.1 5.2 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
PLoS Genet: 2016, 12(4);e1005962
[PubMed:27035918] [WorldCat.org] [DOI] (I e)
⊟Relevant publications[edit | edit source]
D A Heerding, G Chan, W E DeWolf, A P Fosberry, C A Janson, D D Jaworski, E McManus, W H Miller, T D Moore, D J Payne, X Qiu, S F Rittenhouse, C Slater-Radosti, W Smith, D T Takata, K S Vaidya, C C Yuan, W F Huffman
1,4-Disubstituted imidazoles are potential antibacterial agents functioning as inhibitors of enoyl acyl carrier protein reductase (FabI).
Bioorg Med Chem Lett: 2001, 11(16);2061-5
[PubMed:11514139] [WorldCat.org] [DOI] (P p)William H Miller, Mark A Seefeld, Kenneth A Newlander, Irene N Uzinskas, Walter J Burgess, Dirk A Heerding, Catherine C K Yuan, Martha S Head, David J Payne, Stephen F Rittenhouse, Terrance D Moore, Stewart C Pearson, Valerie Berry, Walter E DeWolf, Paul M Keller, Brian J Polizzi, Xiayang Qiu, Cheryl A Janson, William F Huffman
Discovery of aminopyridine-based inhibitors of bacterial enoyl-ACP reductase (FabI).
J Med Chem: 2002, 45(15);3246-56
[PubMed:12109908] [WorldCat.org] [DOI] (P p)Mark A Seefeld, William H Miller, Kenneth A Newlander, Walter J Burgess, Walter E DeWolf, Patricia A Elkins, Martha S Head, Dalia R Jakas, Cheryl A Janson, Paul M Keller, Peter J Manley, Terrance D Moore, David J Payne, Stewart Pearson, Brian J Polizzi, Xiayang Qiu, Stephen F Rittenhouse, Irene N Uzinskas, Nicola G Wallis, William F Huffman
Indole naphthyridinones as inhibitors of bacterial enoyl-ACP reductases FabI and FabK.
J Med Chem: 2003, 46(9);1627-35
[PubMed:12699381] [WorldCat.org] [DOI] (P p)Hua Xu, Todd J Sullivan, Jun-ichiro Sekiguchi, Teruo Kirikae, Iwao Ojima, Christopher F Stratton, Weimin Mao, Fernando L Rock, M R K Alley, Francis Johnson, Stephen G Walker, Peter J Tonge
Mechanism and inhibition of saFabI, the enoyl reductase from Staphylococcus aureus.
Biochemistry: 2008, 47(14);4228-36
[PubMed:18335995] [WorldCat.org] [DOI] (P p)
