Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL1816 [new locus tag: SACOL_RS09310 ]
- pan locus tag?: SAUPAN004454000
- symbol: putA
- pan gene symbol?: putA
- synonym:
- product: proline dehydrogenase
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL1816 [new locus tag: SACOL_RS09310 ]
- symbol: putA
- product: proline dehydrogenase
- replicon: chromosome
- strand: +
- coordinates: 1871486..1872487
- length: 1002
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3236543 NCBI
- RefSeq: YP_186648 NCBI
- BioCyc: see SACOL_RS09310
- MicrobesOnline: 913260 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961ATGGCACTATTAAAGAATTTTTTTATCGGATTATCTAATAATAGTTTTTTAAACAACGCA
GCAAAAAAAGTGGGCCCACGTTTGGGCGCCAATAAAGTCGTTGCCGGAAATACAATTCCA
GAGTTAATTAATACAATCGAATACTTAAATGACAAGAATATCGCTGTTACGGTAGACAAT
TTAGGGGAATTTGTCGGTACAGTTGAAGAAAGTAATCATGCTAAAGAACAAATTTTAACA
ATTATGGACGCGCTTCATCAACATGGCGTAAAGGCACATATGTCTGTTAAATTGAGTCAG
TTAGGTGCAGAATTCGACTTAGAATTAGCTTACCAAAATTTAAGAGAGATTTTACTTAAA
GCAAATACTTACAACAATATGCATATAAATATTGATACTGAAAAATATGCTAGCCTGCAA
CAAATTGTTCAAGTTTTAGATCGCTTAAAAGGCGAATTTAGAAATGTTGGTACTGTAATT
CAAGCATATTTATACGATAGCCACGAATTAGTTGATAAGTACCAAGATTTACGATTACGT
TTGGTTAAAGGTGCATATAAAGAAAACGAATCAATTGCATTTCAATCTAAGGAAGACGTA
GATGCAAATTACATCAAAATAATTGAACAACGTTTGTTAAACGCACGCAATTTCACTTCA
ATTGCAACACATGACCATCGCATCATTAATCATGTAAAACAATTTATGAAAGAAAATCAC
ATTGAAAAAGATCGTATGGAATTCCAAATGCTCTATGGTTTTAGATCAGAGTTAGCAGAA
GAAATCGCAAATGAAGGCTATAATTTCACTATTTATGTACCTTATGGCGATGATTGGTTT
GCGTATTTTATGAGAAGATTAGCAGAACGCCCACAAAACCTATCTCTTGCTGTAAAAGAA
TTTGTGAAACCTGCTGGCTTAAAACGTGTTGGCATAATTGCAGCTTTAGGAGCTACAGTT
ATGTTAGGTTTAAGTACAATTAAAAAATTATGCCGTAAATAG60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1002
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL1816 [new locus tag: SACOL_RS09310 ]
- symbol: PutA
- description: proline dehydrogenase
- length: 333
- theoretical pI: 8.36497
- theoretical MW: 38029.5
- GRAVY: -0.244144
⊟Function[edit | edit source]
- reaction: EC 1.5.99.8? ExPASyTransferred entry: 1.5.5.2
- TIGRFAM: acidobacterial duplicated orphan permease (TIGR03434; HMM-score: 15.5)
- TheSEED :
- Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase)
Amino Acids and Derivatives Proline and 4-hydroxyproline Proline, 4-hydroxyproline uptake and utilization Proline dehydrogenase (EC 1.5.99.8) (Proline oxidase)and 1 more - PFAM: TIM_barrel (CL0036) Pro_dh; Proline dehydrogenase (PF01619; HMM-score: 126.7)and 4 moreno clan defined SPATA2_PUB-like; Spermatogenesis-associated protein 2, PUB-like domain (PF21388; HMM-score: 15.4)PorB; Alpha helical Porin B (PF11565; HMM-score: 13.9)Acetyltrans (CL0257) NMT; Myristoyl-CoA:protein N-myristoyltransferase, N-terminal domain (PF01233; HMM-score: 12.8)TIM_barrel (CL0036) Radical_SAM; Radical SAM superfamily (PF04055; HMM-score: 12.1)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors: FAD
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.67
- Cytoplasmic Membrane Score: 0.01
- Cellwall Score: 0.15
- Extracellular Score: 0.17
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.0363
- Cytoplasmic Membrane Score: 0.7473
- Cell wall & surface Score: 0.0024
- Extracellular Score: 0.214
- LocateP: Intracellular /TMH start AFTER 60
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: Possibly Sec-
- Intracellular possibility: 0.17
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.015058
- TAT(Tat/SPI): 0.002094
- LIPO(Sec/SPII): 0.001817
- predicted transmembrane helices (TMHMM): 1
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MALLKNFFIGLSNNSFLNNAAKKVGPRLGANKVVAGNTIPELINTIEYLNDKNIAVTVDNLGEFVGTVEESNHAKEQILTIMDALHQHGVKAHMSVKLSQLGAEFDLELAYQNLREILLKANTYNNMHINIDTEKYASLQQIVQVLDRLKGEFRNVGTVIQAYLYDSHELVDKYQDLRLRLVKGAYKENESIAFQSKEDVDANYIKIIEQRLLNARNFTSIATHDHRIINHVKQFMKENHIEKDRMEFQMLYGFRSELAEEIANEGYNFTIYVPYGDDWFAYFMRRLAERPQNLSLAVKEFVKPAGLKRVGIIAALGATVMLGLSTIKKLCRK
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Integral membrane [1] [2] [3]
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator: CcpA regulon
CcpA (TF) important in Carbon catabolism; RegPrecise
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
J Proteome Res: 2011, 10(4);1657-66
[PubMed:21323324] [WorldCat.org] [DOI] (I p) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p)