Jump to navigation
Jump to search
NCBI: 10-JUN-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus COL
- locus tag: SACOL0882 [new locus tag: SACOL_RS04530 ]
- pan locus tag?: SAUPAN002838000
- symbol: SACOL0882
- pan gene symbol?: metN1
- synonym:
- product: ABC transporter ATP-binding protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SACOL0882 [new locus tag: SACOL_RS04530 ]
- symbol: SACOL0882
- product: ABC transporter ATP-binding protein
- replicon: chromosome
- strand: +
- coordinates: 900796..901821
- length: 1026
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 3238499 NCBI
- RefSeq: YP_185753 NCBI
- BioCyc: see SACOL_RS04530
- MicrobesOnline: 912353 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021GTGATTGAATTAAAAGAAGTTGTTAAAGAATATCGGACTAAAAATAAAGAAGTCCTTGCT
GTAGATCACGTTAATTTATCGATTCGAGCAGGATCGATTTATGGCGTCATTGGTTTTTCT
GGAGCAGGAAAAAGTACTTTGATTCGAATGTTTAATCATTTAGAAGCGCCTACATCAGGT
GAAGTTATTATAGATGGAGACCATATAGGTCAATTGTCCAAAAATGGATTAAGAGCAAAA
AGACAAAAAGTAAGTATGATCTTCCAACATTTTAATTTGTTATGGTCAAGGACTGTGTTA
AAAAATATTATGTTTCCGCTTGAAATTGCAGGTGTCCCTAGAAGGAGAGCTAAGCAAAAA
GCATTAGAACTTGTCGAACTCGTCGGTTTAAAAGGTAGAGAAAAGGCTTATCCATCAGAG
TTATCAGGTGGACAAAAGCAACGTGTTGGGATTGCACGAGCGTTAGCTAATGATCCAACG
GTCTTGCTTTGTGATGAGGCAACAAGTGCACTTGATCCGCAAACAACAGATGAAATTTTA
GATCTACTACTAAAAATTAGAGAACAACAAAATTTAACAATTGTACTAATTACGCATGAA
ATGCATGTCATTCGTCGTATTTGTGATGAAGTTGCAGTTATGGAAAGTGGTAAAGTGATA
GAACAAGGACCGGTGACACAGGTTTTTGAAAATCCGCAACACACTGTGACAAAACGATTT
GTGAAAGACGATTTAAATGATGATTTCGAAACATCTTTAACAGAATTAGAGCCATTAGAA
AAAGATGCATATATCGTTAGATTAGTTTTCGCTGGTTCAACAACAACCGAGCCTATTGTA
TCGAGTCTATCAACTGCCTATGATATTAAAATTAATATTTTAGAAGCAAATATTAAAAAT
ACAAAAAATGGAACAGTCGGCTTTTTAGTTCTGCATATTCCATATATTTCAAGTGTAGAT
TTCGGAAAATTCGAAAAAGAGTTAATTGAGCGACAAGTTAAAATGGAGGTGTTAAGACAT
GGGTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
1026
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SACOL0882 [new locus tag: SACOL_RS04530 ]
- symbol: SACOL0882
- description: ABC transporter ATP-binding protein
- length: 341
- theoretical pI: 7.32519
- theoretical MW: 38208.9
- GRAVY: -0.134604
⊟Function[edit | edit source]
- reaction: EC 3.6.3.-? ExPASy
- TIGRFAM: D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 358.4)and 72 moreTransport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 235.7)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 211.3)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 208)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 198)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 194)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 191.7)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 190.3)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 186.7)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 186)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 183.6)Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 173.7)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 170.1)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 166)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 166)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 165.6)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 162.3)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 157.4)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 157.3)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 143.7)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 143.4)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 140.9)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 140.9)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 139.2)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 137.2)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 136.9)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 135.9)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 135.9)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 135.1)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 131.8)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 131.8)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 130.6)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 130.6)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 130.3)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 130.3)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 128.5)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 127.8)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 125.7)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 125.6)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 120.2)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 116.3)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 116.3)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 115.7)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 113.7)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 110.3)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 107.9)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 107.9)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 107.4)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 107.4)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 107.4)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 106.5)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 100.1)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 97.7)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 96.6)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 95.3)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 92.3)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 89.8)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 87.9)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 81)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 81)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 79.2)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 76.8)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 69.3)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 69.1)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 69.1)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 68.8)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 66.9)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 45.5)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 42.8)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 40.3)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 37.6)Transport and binding proteins Amino acids, peptides and amines oligopeptide/dipeptide ABC transporter, ATP-binding protein, C-terminal domain (TIGR01727; HMM-score: 12.1)Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone naphthoate synthase (TIGR01929; EC 4.1.3.36; HMM-score: 11.3)
- TheSEED :
- Methionine ABC transporter ATP-binding protein
Amino Acids and Derivatives Lysine, threonine, methionine, and cysteine Methionine Biosynthesis Methionine ABC transporter ATP-binding proteinand 1 more - PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 117.8)and 11 moreACT (CL0070) NIL; NIL domain (PF09383; HMM-score: 55.1)P-loop_NTPase (CL0023) AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 28.9)AAA_22; AAA domain (PF13401; HMM-score: 26.2)SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 22.4)AAA_16; AAA ATPase domain (PF13191; HMM-score: 19.2)Zeta_toxin; Zeta toxin (PF06414; HMM-score: 16.6)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 15.9)MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 14.5)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 13.4)ABC_ATPase; P-loop domain (PF09818; HMM-score: 13.1)SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 11.4)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 1.05
- Cytoplasmic Membrane Score: 8.78
- Cellwall Score: 0.08
- Extracellular Score: 0.09
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.1908
- Cytoplasmic Membrane Score: 0.7918
- Cell wall & surface Score: 0.001
- Extracellular Score: 0.0164
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.010182
- TAT(Tat/SPI): 0.000889
- LIPO(Sec/SPII): 0.001392
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MIELKEVVKEYRTKNKEVLAVDHVNLSIRAGSIYGVIGFSGAGKSTLIRMFNHLEAPTSGEVIIDGDHIGQLSKNGLRAKRQKVSMIFQHFNLLWSRTVLKNIMFPLEIAGVPRRRAKQKALELVELVGLKGREKAYPSELSGGQKQRVGIARALANDPTVLLCDEATSALDPQTTDEILDLLLKIREQQNLTIVLITHEMHVIRRICDEVAVMESGKVIEQGPVTQVFENPQHTVTKRFVKDDLNDDFETSLTELEPLEKDAYIVRLVFAGSTTTEPIVSSLSTAYDIKINILEANIKNTKNGTVGFLVLHIPYISSVDFGKFEKELIERQVKMEVLRHG
⊟Experimental data[edit | edit source]
- experimentally validated: PeptideAtlas
- protein localization: Cytoplasmic [1] [2]
- quantitative data / protein copy number per cell: 983 [3]
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: S-box (transcription termination) regulon
S-box (RNA) important in Methionine biosynthesis; regulatory site identified based on RegPrecise data for N315 RegPrecise
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
PLoS One: 2009, 4(12);e8176
[PubMed:19997597] [WorldCat.org] [DOI] (I e) - ↑ Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
The Staphylococcus aureus proteome.
Int J Med Microbiol: 2014, 304(2);110-20
[PubMed:24439828] [WorldCat.org] [DOI] (I p) - ↑ Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
Sci Rep: 2016, 6;28172
[PubMed:27344979] [WorldCat.org] [DOI] (I e)