Jump to navigation
Jump to search
NCBI: 26-AUG-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA1939 [new locus tag: SA_RS11140 ]
- pan locus tag?: SAUPAN005434000
- symbol: SA1939
- pan gene symbol?: deoC2
- synonym:
- product: deoxyribose-phosphate aldolase
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: SA1939 [new locus tag: SA_RS11140 ]
- symbol: SA1939
- product: deoxyribose-phosphate aldolase
- replicon: chromosome
- strand: -
- coordinates: 2188926..2189588
- length: 663
- essential: yes [1] DEG other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 1124840 NCBI
- RefSeq: NP_375244 NCBI
- BioCyc: see SA_RS11140
- MicrobesOnline: 104270 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661ATGAATAGTGCAAAATTGATTGATCACACTTTATTGAAGCCTGAGTCAACACGTACGCAA
ATCGATCAAATCATCGATGAAGCGAAAGCATACCATTTTAAATCTGTATGTGTGAATCCA
ACGCATGTTAAATATGCAGCAGAGCGACTAGCTGATTCAGAGGTGTTAGTTTGTACGGTA
ATAGGATTCCCATTAGGTGCATCGACAACTGCGACGAAAGCATTTGAAACAGAAGATGCG
ATTCAAAATGGTGCAGATGAAATTGACATGGTCATCAACATCGGCGCATTAAAAGATGGA
CGTTTTGATGATGTACAACAAGACATTGAAGCAGTGGTGAAAGCTGCGAAAGGTCACACA
GTAAAAGTGATTATTGAGACGGTATTGTTGGACCATGACGAAATCGTAAAAGCGAGTGAA
TTAACAAAAGTGGCTGGTGCGGACTTCGTTAAAACTTCAACAGGTTTTGCAGGTGGCGGT
GCGACTGCAGAAGACGTTAAATTAATGAAAGATACAGTAGGTGCTGATGTAGAAGTAAAA
GCATCAGGTGGCGTACGTAATTTAGAAGATTTCAATAAAATGGTTGAAGCAGGTGCGACA
CGTATTGGTGCGAGCGCAGGCGTTCAAATTATGCAAGGTTTAGAAGCAGATTCAGATTAC
TAA60
120
180
240
300
360
420
480
540
600
660
663
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA1939 [new locus tag: SA_RS11140 ]
- symbol: SA1939
- description: deoxyribose-phosphate aldolase
- length: 220
- theoretical pI: 4.47623
- theoretical MW: 23341.2
- GRAVY: -0.0640909
⊟Function[edit | edit source]
- reaction: EC 4.1.2.4? ExPASyDeoxyribose-phosphate aldolase 2-deoxy-D-ribose 5-phosphate = D-glyceraldehyde 3-phosphate + acetaldehyde
- TIGRFAM: Energy metabolism Other deoxyribose-phosphate aldolase (TIGR00126; EC 4.1.2.4; HMM-score: 286.3)Purines, pyrimidines, nucleosides, and nucleotides Other deoxyribose-phosphate aldolase (TIGR00126; EC 4.1.2.4; HMM-score: 286.3)and 1 morepredicted phospho-2-dehydro-3-deoxyheptonate aldolase (TIGR01949; EC 4.2.1.-; HMM-score: 18.5)
- TheSEED :
- Deoxyribose-phosphate aldolase (EC 4.1.2.4)
- PFAM: TIM_barrel (CL0036) DeoC; DeoC/LacD family aldolase (PF01791; HMM-score: 92.2)and 2 moreHis_biosynth; Histidine biosynthesis protein (PF00977; HMM-score: 16.3)G3P_antiterm; Glycerol-3-phosphate responsive antiterminator (PF04309; HMM-score: 14.7)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 9.97
- Cytoplasmic Membrane Score: 0
- Cellwall Score: 0.01
- Extracellular Score: 0.02
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.9987
- Cytoplasmic Membrane Score: 0.0002
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.0011
- LocateP: Intracellular
- Prediction by SwissProt Classification: Cytoplasmic
- Pathway Prediction: No pathway
- Intracellular possibility: 1
- Signal peptide possibility: -1
- N-terminally Anchored Score: 1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.014554
- TAT(Tat/SPI): 0.000358
- LIPO(Sec/SPII): 0.000808
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MNSAKLIDHTLLKPESTRTQIDQIIDEAKAYHFKSVCVNPTHVKYAAERLADSEVLVCTVIGFPLGASTTATKAFETEDAIQNGADEIDMVINIGALKDGRFDDVQQDIEAVVKAAKGHTVKVIIETVLLDHDEIVKASELTKVAGADFVKTSTGFAGGGATAEDVKLMKDTVGADVEVKASGGVRNLEDFNKMVEAGATRIGASAGVQIMQGLEADSDY
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- regulator: CcpA regulon
CcpA (TF) important in Carbon catabolism; RegPrecise
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
Mol Microbiol: 2002, 43(6);1387-400
[PubMed:11952893] [WorldCat.org] [DOI] (P p)
⊟Relevant publications[edit | edit source]
Alexander Scherl, Patrice François, Manuela Bento, Jacques M Deshusses, Yvan Charbonnier, Véronique Converset, Antoine Huyghe, Nadia Walter, Christine Hoogland, Ron D Appel, Jean-Charles Sanchez, Catherine G Zimmermann-Ivol, Garry L Corthals, Denis F Hochstrasser, Jacques Schrenzel
Correlation of proteomic and transcriptomic profiles of Staphylococcus aureus during the post-exponential phase of growth.
J Microbiol Methods: 2005, 60(2);247-57
[PubMed:15590099] [WorldCat.org] [DOI] (P p)