From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_RS06445 [old locus tag: NWMN_1142 ]
  • pan locus tag?: SAUPAN003519000
  • symbol: NWMN_RS06445
  • pan gene symbol?: acpP
  • synonym:
  • product: acyl carrier protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_RS06445 [old locus tag: NWMN_1142 ]
  • symbol: NWMN_RS06445
  • product: acyl carrier protein
  • replicon: chromosome
  • strand: +
  • coordinates: 1251502..1251735
  • length: 234
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Location: NC_009641 (1251502..1251735) NCBI
  • BioCyc:
  • MicrobesOnline: see NWMN_1142

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    GTGGAAAATTTCGATAAAGTAAAAGATATCATCGTTGACCGTTTAGGTGTAGACGCTGAT
    AAAGTAACTGAAGATGCATCTTTCAAAGATGATTTAGGCGCTGACTCACTTGATATCGCT
    GAATTAGTAATGGAATTAGAAGACGAGTTTGGTACTGAAATTCCTGATGAAGAAGCTGAA
    AAAATCAACACTGTTGGTGATGCTGTTAAATTTATTAACAGTCTTGAAAAATAA
    60
    120
    180
    234

Protein[edit | edit source]

Protein Data Bank: 4DXE

General[edit | edit source]

  • locus tag: NWMN_RS06445 [old locus tag: NWMN_1142 ]
  • symbol: NWMN_RS06445
  • description: acyl carrier protein
  • length: 77
  • theoretical pI: 3.72176
  • theoretical MW: 8549.37
  • GRAVY: -0.376623

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Fatty acid and phospholipid metabolism Biosynthesis acyl carrier protein (TIGR00517; HMM-score: 109.8)
    and 1 more
    Cellular processes Cellular processes Toxin production and resistance peptide maturation system acyl carrier-related protein (TIGR04069; HMM-score: 17.9)
  • TheSEED: data available for COL, N315, NCTC8325, USA300_FPR3757
  • PFAM:
    PP-binding (CL0314) PP-binding; Phosphopantetheine attachment site (PF00550; HMM-score: 59.5)
    and 3 more
    PP-binding_2; Acyl-carrier (PF14573; HMM-score: 16.4)
    Ribosomal_L50; Ribosomal subunit 39S (PF10501; HMM-score: 15.9)
    no clan defined Ribosomal_L12_N; Ribosomal protein L7/L12 dimerisation domain (PF16320; HMM-score: 13.5)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.003188
    • TAT(Tat/SPI): 0.000506
    • LIPO(Sec/SPII): 0.00048
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MENFDKVKDIIVDRLGVDADKVTEDASFKDDLGADSLDIAELVMELEDEFGTEIPDEEAEKINTVGDAVKFINSLEK

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    NWMN_RS04805beta-ketoacyl-[acyl-carrier-protein] synthase II  [1] (data from MRSA252)
    NWMN_RS071254-hydroxybenzoyl-CoA thioesterase  [1] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. 1.0 1.1 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]