From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_2337 [new locus tag: NWMN_RS13455 ]
  • pan locus tag?: SAUPAN005986000
  • symbol: NWMN_2337
  • pan gene symbol?:
  • synonym:
  • product: amino acid permease

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_2337 [new locus tag: NWMN_RS13455 ]
  • symbol: NWMN_2337
  • product: amino acid permease
  • replicon: chromosome
  • strand: +
  • coordinates: 2567111..2568520
  • length: 1410
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGGCAAGAAAATTGCATAGAGAGTTGAATAACAGACACATCCAATTAATAGCAATTGGG
    GGCGCAATTGGAACTGGGTTATTCCTAGGATCAGGTCAAACAATATCTTTAACTGGTCCA
    TCACTGTTATTCACATACATGATTATTGGGGTTGTACTATTCGCTTTTATGCGCGCATTA
    GGCGAATTGTTGTTGAGCAATACAAGATTTAATTCATTTGTTGATATTGCAAATGAATAT
    TTAGGCCCTTTTGGTGGCTTTGTCATTGGCTGGACTTACTGGTTATGTTGGATTGTATCA
    AGTATGTCAGACCTAACTGCGATGGGACAATACTTTGCATTTTGGTATCCACAAGTCCCA
    AATTGGATTACCGTGCTATTTATTGTTTTAATCTTGATTAGCTTCAACTTATTAGGTGCC
    AGATTATTTGGTGAACTGGAGTTTTGGTTCTCGATTATTAAAGTTGTCACAATTATTGCG
    ATGGTTATCGTTGGTCTTGTATTAATCTTTTTCTCATTTAAAACACATTATGGACATGCA
    TCATTCACAAACTTAATCAGTCACGGTGGCATGTTCCCTGGTGGAACATTTGGTTTCTTA
    ATGTCATTCCAAATTGCTGTATATTCATTCATTGGTATTGAACTTATAGGTGTAACTGCT
    GGTGAAACGAAAGATCCTGAAAAAACCTTACCGAAAGCAATTAATAATGTACCTATCCGT
    ATTTTATTATTCTATATCGGTGGTCTATTAGTAATTATGTCAGTCATACCTTGGAATGAT
    ATCGATCCAAATAGTAGCCCTTTCGTTAAACTCTTTACATTAATCGGCGTACCATTTGCA
    GCAGGTGTCGTTAACTTTGTCGTGCTAACTGCCGCGGCCTCTGCTACAAATAGTGGTATC
    TATTCGAATAGTCGTATCTTATTCGGACTGTCACAACAAGGGTTAGGTCCTAAAGTTTTA
    AATAAAACGAATAGTCATGGCGTGCCTTATTTATCAATGTTAGTTTCATCAATTGCATTA
    CTTATAGCAGCCTTGTTAAACTACATTTTCCCTAATGCAATTCAACTATTCATATACGTT
    ACAACGTTATCAACTGTGTTGTTTTTAGTTGTTTGGGCAATGATTATTGTCGCTTATCTA
    ATGTATTTGAAAAAGCATCCTGAGGCACATAAAAACAGTAAATTTAAGTTGATTGGTGGT
    AAGCCTATTGCTTACATTATTCTAGCGTTCTTCTTCTTTGTATTCATTTTATTATTCTTT
    AGTGACGAAACAAGAGCAGCTATTTATATTTCGCCATTCTGGTTTATATTTTTATTTTTC
    TTTTATAAAAAATACAAAACGAATGCTGAAAAGCTCGCGTATGAACAACGACAAAATGAC
    AGCGGTCATTTCAGATATGACAATCAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1410

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_2337 [new locus tag: NWMN_RS13455 ]
  • symbol: NWMN_2337
  • description: amino acid permease
  • length: 469
  • theoretical pI: 9.77747
  • theoretical MW: 52557.8
  • GRAVY: 0.727505

Function[edit | edit source]

  • TIGRFAM:
    Metabolism Transport and binding proteins Amino acids, peptides and amines GABA permease (TIGR01773; HMM-score: 311)
    Metabolism Transport and binding proteins Amino acids, peptides and amines amino acid permease (yeast) (TIGR00913; HMM-score: 269)
    and 10 more
    Metabolism Transport and binding proteins Amino acids, peptides and amines amino acid transporter (TIGR00909; HMM-score: 127.3)
    Metabolism Transport and binding proteins Amino acids, peptides and amines ethanolamine permease (TIGR00908; HMM-score: 91.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines transporter, basic amino acid/polyamine antiporter (APA) family (TIGR00905; HMM-score: 72.3)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cationic amino acid transport permease (TIGR00906; HMM-score: 68.4)
    histidine-histamine antiporter (TIGR04298; HMM-score: 65.8)
    putative glutamate/gamma-aminobutyrate antiporter (TIGR03813; HMM-score: 50.5)
    Metabolism Transport and binding proteins Amino acids, peptides and amines arginine-ornithine antiporter (TIGR03810; HMM-score: 32.8)
    putrescine-ornithine antiporter (TIGR04299; HMM-score: 20.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines spore germination protein (amino acid permease) (TIGR00912; HMM-score: 14.6)
    Metabolism Energy metabolism Electron transport cytochrome c oxidase, subunit II (TIGR02866; EC 1.9.3.1; HMM-score: 9.3)
  • TheSEED  :
    • D-serine/D-alanine/glycine transporter
    Amino Acids and Derivatives Alanine, serine, and glycine Glycine and Serine Utilization  D-serine/D-alanine/glycine transporter
    and 1 more
    Carbohydrates Central carbohydrate metabolism Pyruvate Alanine Serine Interconversions  D-serine/D-alanine/glycine transporter
  • PFAM:
    APC (CL0062) AA_permease; Amino acid permease (PF00324; HMM-score: 366.5)
    and 2 more
    AA_permease_2; Amino acid permease (PF13520; HMM-score: 149.8)
    Spore_permease; Spore germination protein (PF03845; HMM-score: 19)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 10
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 12
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.9997
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.0003
  • LocateP: Multi-transmembrane
    • Prediction by SwissProt Classification: Membrane
    • Pathway Prediction: Sec-(SPI)
    • Intracellular possibility: 0.17
    • Signal peptide possibility: -0.5
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.015444
    • TAT(Tat/SPI): 0.004814
    • LIPO(Sec/SPII): 0.083446
  • predicted transmembrane helices (TMHMM): 12

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MARKLHRELNNRHIQLIAIGGAIGTGLFLGSGQTISLTGPSLLFTYMIIGVVLFAFMRALGELLLSNTRFNSFVDIANEYLGPFGGFVIGWTYWLCWIVSSMSDLTAMGQYFAFWYPQVPNWITVLFIVLILISFNLLGARLFGELEFWFSIIKVVTIIAMVIVGLVLIFFSFKTHYGHASFTNLISHGGMFPGGTFGFLMSFQIAVYSFIGIELIGVTAGETKDPEKTLPKAINNVPIRILLFYIGGLLVIMSVIPWNDIDPNSSPFVKLFTLIGVPFAAGVVNFVVLTAAASATNSGIYSNSRILFGLSQQGLGPKVLNKTNSHGVPYLSMLVSSIALLIAALLNYIFPNAIQLFIYVTTLSTVLFLVVWAMIIVAYLMYLKKHPEAHKNSKFKLIGGKPIAYIILAFFFFVFILLFFSDETRAAIYISPFWFIFLFFFYKKYKTNAEKLAYEQRQNDSGHFRYDNQ

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulators: CcpA regulon, CodY (repression) regulon
    CcpA(TF)important in Carbon catabolism; RegPrecise 
    CodY(TF)important in Amino acid metabolism; RegPrecise 

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]