Jump to navigation
Jump to search
NCBI: 06-JUL-2013
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus Newman
- locus tag: NWMN_2337 [new locus tag: NWMN_RS13455 ]
- pan locus tag?: SAUPAN005986000
- symbol: NWMN_2337
- pan gene symbol?: —
- synonym:
- product: amino acid permease
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: NWMN_2337 [new locus tag: NWMN_RS13455 ]
- symbol: NWMN_2337
- product: amino acid permease
- replicon: chromosome
- strand: +
- coordinates: 2567111..2568520
- length: 1410
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID: 5331430 NCBI
- RefSeq: YP_001333371 NCBI
- BioCyc:
- MicrobesOnline: 3707939 MicrobesOnline
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081
1141
1201
1261
1321
1381ATGGCAAGAAAATTGCATAGAGAGTTGAATAACAGACACATCCAATTAATAGCAATTGGG
GGCGCAATTGGAACTGGGTTATTCCTAGGATCAGGTCAAACAATATCTTTAACTGGTCCA
TCACTGTTATTCACATACATGATTATTGGGGTTGTACTATTCGCTTTTATGCGCGCATTA
GGCGAATTGTTGTTGAGCAATACAAGATTTAATTCATTTGTTGATATTGCAAATGAATAT
TTAGGCCCTTTTGGTGGCTTTGTCATTGGCTGGACTTACTGGTTATGTTGGATTGTATCA
AGTATGTCAGACCTAACTGCGATGGGACAATACTTTGCATTTTGGTATCCACAAGTCCCA
AATTGGATTACCGTGCTATTTATTGTTTTAATCTTGATTAGCTTCAACTTATTAGGTGCC
AGATTATTTGGTGAACTGGAGTTTTGGTTCTCGATTATTAAAGTTGTCACAATTATTGCG
ATGGTTATCGTTGGTCTTGTATTAATCTTTTTCTCATTTAAAACACATTATGGACATGCA
TCATTCACAAACTTAATCAGTCACGGTGGCATGTTCCCTGGTGGAACATTTGGTTTCTTA
ATGTCATTCCAAATTGCTGTATATTCATTCATTGGTATTGAACTTATAGGTGTAACTGCT
GGTGAAACGAAAGATCCTGAAAAAACCTTACCGAAAGCAATTAATAATGTACCTATCCGT
ATTTTATTATTCTATATCGGTGGTCTATTAGTAATTATGTCAGTCATACCTTGGAATGAT
ATCGATCCAAATAGTAGCCCTTTCGTTAAACTCTTTACATTAATCGGCGTACCATTTGCA
GCAGGTGTCGTTAACTTTGTCGTGCTAACTGCCGCGGCCTCTGCTACAAATAGTGGTATC
TATTCGAATAGTCGTATCTTATTCGGACTGTCACAACAAGGGTTAGGTCCTAAAGTTTTA
AATAAAACGAATAGTCATGGCGTGCCTTATTTATCAATGTTAGTTTCATCAATTGCATTA
CTTATAGCAGCCTTGTTAAACTACATTTTCCCTAATGCAATTCAACTATTCATATACGTT
ACAACGTTATCAACTGTGTTGTTTTTAGTTGTTTGGGCAATGATTATTGTCGCTTATCTA
ATGTATTTGAAAAAGCATCCTGAGGCACATAAAAACAGTAAATTTAAGTTGATTGGTGGT
AAGCCTATTGCTTACATTATTCTAGCGTTCTTCTTCTTTGTATTCATTTTATTATTCTTT
AGTGACGAAACAAGAGCAGCTATTTATATTTCGCCATTCTGGTTTATATTTTTATTTTTC
TTTTATAAAAAATACAAAACGAATGCTGAAAAGCTCGCGTATGAACAACGACAAAATGAC
AGCGGTCATTTCAGATATGACAATCAATAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
1080
1140
1200
1260
1320
1380
1410
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: NWMN_2337 [new locus tag: NWMN_RS13455 ]
- symbol: NWMN_2337
- description: amino acid permease
- length: 469
- theoretical pI: 9.77747
- theoretical MW: 52557.8
- GRAVY: 0.727505
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Amino acids, peptides and amines GABA permease (TIGR01773; HMM-score: 311)Transport and binding proteins Amino acids, peptides and amines amino acid permease (yeast) (TIGR00913; HMM-score: 269)and 10 moreTransport and binding proteins Amino acids, peptides and amines amino acid transporter (TIGR00909; HMM-score: 127.3)Transport and binding proteins Amino acids, peptides and amines ethanolamine permease (TIGR00908; HMM-score: 91.4)Transport and binding proteins Amino acids, peptides and amines transporter, basic amino acid/polyamine antiporter (APA) family (TIGR00905; HMM-score: 72.3)Transport and binding proteins Amino acids, peptides and amines cationic amino acid transport permease (TIGR00906; HMM-score: 68.4)histidine-histamine antiporter (TIGR04298; HMM-score: 65.8)putative glutamate/gamma-aminobutyrate antiporter (TIGR03813; HMM-score: 50.5)Transport and binding proteins Amino acids, peptides and amines arginine-ornithine antiporter (TIGR03810; HMM-score: 32.8)putrescine-ornithine antiporter (TIGR04299; HMM-score: 20.6)Transport and binding proteins Amino acids, peptides and amines spore germination protein (amino acid permease) (TIGR00912; HMM-score: 14.6)Energy metabolism Electron transport cytochrome c oxidase, subunit II (TIGR02866; EC 1.9.3.1; HMM-score: 9.3)
- TheSEED :
- D-serine/D-alanine/glycine transporter
Amino Acids and Derivatives Alanine, serine, and glycine Glycine and Serine Utilization D-serine/D-alanine/glycine transporterand 1 more - PFAM: APC (CL0062) AA_permease; Amino acid permease (PF00324; HMM-score: 366.5)and 2 moreAA_permease_2; Amino acid permease (PF13520; HMM-score: 149.8)Spore_permease; Spore germination protein (PF03845; HMM-score: 19)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 10
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 12
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0
- Cytoplasmic Membrane Score: 0.9997
- Cell wall & surface Score: 0
- Extracellular Score: 0.0003
- LocateP: Multi-transmembrane
- Prediction by SwissProt Classification: Membrane
- Pathway Prediction: Sec-(SPI)
- Intracellular possibility: 0.17
- Signal peptide possibility: -0.5
- N-terminally Anchored Score: -1
- Predicted Cleavage Site: No CleavageSite
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.015444
- TAT(Tat/SPI): 0.004814
- LIPO(Sec/SPII): 0.083446
- predicted transmembrane helices (TMHMM): 12
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MARKLHRELNNRHIQLIAIGGAIGTGLFLGSGQTISLTGPSLLFTYMIIGVVLFAFMRALGELLLSNTRFNSFVDIANEYLGPFGGFVIGWTYWLCWIVSSMSDLTAMGQYFAFWYPQVPNWITVLFIVLILISFNLLGARLFGELEFWFSIIKVVTIIAMVIVGLVLIFFSFKTHYGHASFTNLISHGGMFPGGTFGFLMSFQIAVYSFIGIELIGVTAGETKDPEKTLPKAINNVPIRILLFYIGGLLVIMSVIPWNDIDPNSSPFVKLFTLIGVPFAAGVVNFVVLTAAASATNSGIYSNSRILFGLSQQGLGPKVLNKTNSHGVPYLSMLVSSIALLIAALLNYIFPNAIQLFIYVTTLSTVLFLVVWAMIIVAYLMYLKKHPEAHKNSKFKLIGGKPIAYIILAFFFFVFILLFFSDETRAAIYISPFWFIFLFFFYKKYKTNAEKLAYEQRQNDSGHFRYDNQ
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulators: CcpA regulon, CodY (repression) regulon
CcpA (TF) important in Carbon catabolism; RegPrecise CodY (TF) important in Amino acid metabolism; RegPrecise
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]