From AureoWiki
Jump to navigation Jump to search

NCBI: 06-JUL-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus Newman
  • locus tag: NWMN_1078 [new locus tag: NWMN_RS06110 ]
  • pan locus tag?: SAUPAN003429000
  • symbol: argF
  • pan gene symbol?: argF
  • synonym:
  • product: ornithine carbamoyltransferase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: NWMN_1078 [new locus tag: NWMN_RS06110 ]
  • symbol: argF
  • product: ornithine carbamoyltransferase
  • replicon: chromosome
  • strand: +
  • coordinates: 1181579..1182589
  • length: 1011
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    TTGTTATTAATGAAAAATTTACGAAACAGAAGTTTTTTAACTTTATTAGACTTTTCACGA
    CAAGAGGTAGAATTCTTATTAACACTCTCCGAGGATTTAAAACGTGCTAAATATATTGGC
    ACTGAAAAGCCTATGTTAAAAAATAAAAATATTGCACTGTTATTTGAAAAAGATTCTACA
    AGAACGCGATGTGCATTTGAAGTTGCAGCGCATGATCAAGGTGCAAATGTAACTTATTTA
    GGCCCAACTGGATCACAAATGGGTAAAAAAGAAACAACTAAAGATACTGCACGTGTGCTT
    GGTGGAATGTATGATGGCATTGAATACCGTGGTTTTTCACAAAGAACAGTAGAAACTTTA
    GCTGAGTATTCAGGCGTACCAGTGTGGAATGGTTTAACTGATGAAGATCATCCTACTCAA
    GTTCTTGCTGATTTCTTAACAGCAAAAGAAGTCTTAAAAAAAGATTATGCAGATATTAAC
    TTTACATATGTTGGAGATGGTCGTAATAACGTTGCAAATGCATTAATGCAAGGTGCTGCC
    ATTATGGGTATGAACTTCCATTTAGTTTGTCCAAAAGAATTAAATCCAACAGATGAATTA
    TTAAATCGCTGTAAAAATATTGCCGCTGAAAATGGTGGCAACATATTAATCACAGATGAT
    ATTGACCAAGGTGTAAAAGGTTCGGATGTAATTTACACTGATGTTTGGGTATCAATGGGT
    GAACCTGATGAAGTATGGAAAGAACGACTTGAATTATTGAAACCATATCAAGTAAATAAA
    GAAATAATGGATAAAACTGGTAATCCAAATGTTATTTTTGAGCATTGCTTACCATCTTTC
    CATAATGCTGATACGAAAATAGGTCAACAAATTTTTGAAAAATATGGTATTCGAGAAATG
    GAAGTTACAGATGAAGTATTCGAAAGTAAAGCTTCAGTTGTATTCCAAGAAGCTGAGAAC
    AGAATGCATACAATCAAAGCAGTCATGGTTGCTACATTGGGTGAATTTTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1011

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: NWMN_1078 [new locus tag: NWMN_RS06110 ]
  • symbol: ArgF
  • description: ornithine carbamoyltransferase
  • length: 336
  • theoretical pI: 4.81544
  • theoretical MW: 37873.9
  • GRAVY: -0.365774

Function[edit | edit source]

  • reaction:
    EC 2.1.3.3?  ExPASy
    Ornithine carbamoyltransferase Carbamoyl phosphate + L-ornithine = phosphate + L-citrulline
  • TIGRFAM:
    Metabolism Amino acid biosynthesis Glutamate family ornithine carbamoyltransferase (TIGR00658; EC 2.1.3.3; HMM-score: 407.6)
    and 3 more
    Metabolism Energy metabolism Amino acids and amines putrescine carbamoyltransferase (TIGR04384; EC 2.1.3.6; HMM-score: 266.6)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Pyrimidine ribonucleotide biosynthesis aspartate carbamoyltransferase (TIGR00670; EC 2.1.3.2; HMM-score: 120.3)
    knotted carbamoyltransferase YgeW (TIGR03316; EC 2.1.3.-; HMM-score: 64.6)
  • TheSEED  :
    • Ornithine carbamoyltransferase (EC 2.1.3.3)
    Amino Acids and Derivatives Arginine; urea cycle, polyamines Arginine and Ornithine Degradation  Ornithine carbamoyltransferase (EC 2.1.3.3)
    and 2 more
    Amino Acids and Derivatives Arginine; urea cycle, polyamines Arginine Biosynthesis extended  Ornithine carbamoyltransferase (EC 2.1.3.3)
    Amino Acids and Derivatives Arginine; urea cycle, polyamines Arginine Deiminase Pathway  Ornithine carbamoyltransferase (EC 2.1.3.3)
  • PFAM:
    NADP_Rossmann (CL0063) OTCace; Aspartate/ornithine carbamoyltransferase, Asp/Orn binding domain (PF00185; HMM-score: 185.1)
    no clan defined OTCace_N; Aspartate/ornithine carbamoyltransferase, carbamoyl-P binding domain (PF02729; HMM-score: 156.5)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9297
    • Cytoplasmic Membrane Score: 0.0006
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.0697
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: -1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.002812
    • TAT(Tat/SPI): 0.000598
    • LIPO(Sec/SPII): 0.000551
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MLLMKNLRNRSFLTLLDFSRQEVEFLLTLSEDLKRAKYIGTEKPMLKNKNIALLFEKDSTRTRCAFEVAAHDQGANVTYLGPTGSQMGKKETTKDTARVLGGMYDGIEYRGFSQRTVETLAEYSGVPVWNGLTDEDHPTQVLADFLTAKEVLKKDYADINFTYVGDGRNNVANALMQGAAIMGMNFHLVCPKELNPTDELLNRCKNIAAENGGNILITDDIDQGVKGSDVIYTDVWVSMGEPDEVWKERLELLKPYQVNKEIMDKTGNPNVIFEHCLPSFHNADTKIGQQIFEKYGIREMEVTDEVFESKASVVFQEAENRMHTIKAVMVATLGEF

Experimental data[edit | edit source]

  • experimentally validated: data available for NCTC8325
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • data available for JSNZ

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]