Jump to navigation
Jump to search
FunGene: 08-OCT-2024
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: JSNZ_002620
- pan locus tag?: SAUPAN006359000
- symbol: JSNZ_002620
- pan gene symbol?: arcR
- synonym:
- product: Crp/Fnr family transcriptional regulator
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: JSNZ_002620
- symbol: JSNZ_002620
- product: Crp/Fnr family transcriptional regulator
- replicon: chromosome
- strand: -
- coordinates: 2625683..2626387
- length: 705
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661ATGACAGAAAACTTTATTTTGGGTAGAAATAATAAATTAGAACATGAACTAAAGGCATTA
GCAGATTACATTAATATCCCATATAGTATATTACAACCATATCAAAGTGAATGTTTTGTC
AGACATTATACGAAAGGCCAAGTTATTTATTTTTCGCCACAAGAAAGTAGCAATATTTAC
TTTTTAATTGAAGGTAACATTATTAGAGAACATTACAATCAAAATGGAGATGTATATCGT
TATTTTAATAAAGAGCAAGTATTATTTCCAATCAGTAACTTATTTCATCCGAAAGAGGTT
AATGAATTGTGTACAGCATTAACCGATTGTACAGTTCTTGGATTGCCTAGAGAATTGATG
GCCTTTTTGTGCAAAGCTAATGATGATATATTTTTGACACTTTTTGCATTAATAAATGAT
AATGAGCAGCAACACATGAACTATAACATGGCATTAACAAGTAAATTTGCTAAAGATCGA
ATTATTAAATTGTTATGTCATATATGTCAGACAGTAGGGTACGATCAAGATGAATTTTAT
GAAATCAAACAGTTTTTAACTATTCAACTCATGAGTGATATGGCTGGGATTTCCCGGGAA
ACAGCTGGTCATATTATTCATGAACTTAAAGATGAAAAACTTGTTGTTAAAGATCATAAA
AATTGGTTAGTAAGCAAACATTTATTCAATGATGTATGTGTTTAA60
120
180
240
300
360
420
480
540
600
660
705
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JSNZ_002620
- symbol: JSNZ_002620
- description: Crp/Fnr family transcriptional regulator
- length: 234
- theoretical pI: 5.97765
- theoretical MW: 27428.3
- GRAVY: -0.217949
⊟Function[edit | edit source]
- TIGRFAM: Regulatory functions DNA interactions global nitrogen regulator NtcA (TIGR03697; HMM-score: 26.3)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: Cupin (CL0029) cNMP_binding; Cyclic nucleotide-binding domain (PF00027; HMM-score: 33)HTH (CL0123) HTH_Crp_2; Crp-like helix-turn-helix domain (PF13545; HMM-score: 28.6)and 3 moreDIP2311-like_C; Transcriptional regulator DIP2311-like, C-terminal domain (PF22168; HMM-score: 16.4)MIF (CL0082) Tautomerase; Tautomerase enzyme (PF01361; HMM-score: 14.5)no clan defined Catalase-rel; Catalase-related immune-responsive (PF06628; HMM-score: 12.8)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effector: Arginine
⊟Localization[edit | edit source]
- PSORTb: unknown (no significant prediction)
- Cytoplasmic Score: 2.5
- Cytoplasmic Membrane Score: 2.5
- Cellwall Score: 2.5
- Extracellular Score: 2.5
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.944
- Cytoplasmic Membrane Score: 0.0391
- Cell wall & surface Score: 0.0002
- Extracellular Score: 0.0167
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.004428
- TAT(Tat/SPI): 0.000272
- LIPO(Sec/SPII): 0.000783
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
- MTENFILGRNNKLEHELKALADYINIPYSILQPYQSECFVRHYTKGQVIYFSPQESSNIYFLIEGNIIREHYNQNGDVYRYFNKEQVLFPISNLFHPKEVNELCTALTDCTVLGLPRELMAFLCKANDDIFLTLFALINDNEQQHMNYNMALTSKFAKDRIIKLLCHICQTVGYDQDEFYEIKQFLTIQLMSDMAGISRETAGHIIHELKDEKLVVKDHKNWLVSKHLFNDVCV
⊟Experimental data[edit | edit source]
- experimentally validated: data available for NCTC8325
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulators: Rex* (repression) regulon, ArcR* (activation) regulon, ArgR/AhrC (repression) regulon, CcpA regulon
Rex* (TF) important in Energy metabolism; regulation predicted or transferred from N315 and NCTC 8325 in Wolfgramm et al. (https://doi.org/10.1101/2025.09.03.674026) ArcR* (TF) important in Arginine degradation; regulation predicted or transferred from N315 and NCTC 8325 in Wolfgramm et al. (https://doi.org/10.1101/2025.09.03.674026) ArgR/AhrC (TF) important in Arginine biosynthesis, Arginine degradation; regulation predicted or transferred from N315 and NCTC 8325 in Wolfgramm et al. (https://doi.org/10.1101/2025.09.03.674026) CcpA (TF) important in Carbon catabolism; regulation predicted or transferred from N315 and NCTC 8325 in Wolfgramm et al. (https://doi.org/10.1101/2025.09.03.674026)
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
Bioinformatics: 2018, 34(23);4118-4120
[PubMed:29931111] [WorldCat.org] [DOI] (I p)