From AureoWiki
Jump to navigation Jump to search

FunGene: 08-OCT-2024

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: JSNZ_002383
  • pan locus tag?: SAUPAN005946000
  • symbol: JSNZ_002383
  • pan gene symbol?: tcyC
  • synonym:
  • product: amino acid ABC transporter ATP-binding protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: JSNZ_002383
  • symbol: JSNZ_002383
  • product: amino acid ABC transporter ATP-binding protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2380620..2381351
  • length: 732
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq:
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGATTCAATTGAACAATATCCATAAATCATTCAATGATGTTGAAGTCATCAAAGGTATT
    GATTTATCTGTTGAACAAGGTGAGGTTGTAACCTTAATCGGTCGATCTGGTTCAGGTAAA
    ACAACATTGTTACGTATGATTAATGCATTAGAAATTCCAACTGAAGGTACAGTTTATGTT
    AACGGCAAAACATATACATCTAAAGATAAAAAATCACAAATAGAAGTTCGTAAACAGTCT
    GGTATGGTATTTCAAAGTTATAACCTTTTTCCGCATAAGACGGCATTAGAAAATGTAATG
    GAAGGTCTTATCACAGTTAAAAAGTTGAAAAAGGATGAGGCACGTGGGAAATCACTTGAG
    TTACTTGAGAAAGTTGGTTTAACACATGTCAAAGATCAACGTCCACATGCATTATCAGGT
    GGTCAACAACAACGTGTTGCTATTGCAAGAGCACTAGCAATGAACCCTAAAGTGATGTTG
    TTTGATGAACCAACATCTGCACTTGATCCTGAACTTGTGAATGATGTTTTAAAGGTTATT
    AAAGATTTGGCTAATGAAGGCATGACAATGGTCATTGTGACACATGAAATGCGTTTTGCT
    AAAGAAGTATCTAATAACATTGTATTTATTCATGAAGGCATGATCGGAGAACAAGGGGCT
    CCAGAAGAGATGTTCAATCGTCCGAAAACAGAAGAATTAAGACGTTTCTTAAATGTTATA
    AATGAAGAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    732

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: JSNZ_002383
  • symbol: JSNZ_002383
  • description: amino acid ABC transporter ATP-binding protein
  • length: 243
  • theoretical pI: 7.18777
  • theoretical MW: 27241.3
  • GRAVY: -0.311111

Function[edit | edit source]

  • TIGRFAM:
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 280.4)
    and 80 more
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 221.3)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 216)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 214.1)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 207.1)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 204.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 201.3)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 194.4)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 190.3)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 189.8)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 189.8)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 185.2)
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 183.7)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 181.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 173.8)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 165.9)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 165.2)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 163.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 160.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 160.4)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 156.5)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 156.5)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 152.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 152.1)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 150.5)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 143.1)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 143.1)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 133.7)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 133.6)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 132.8)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 132.2)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 132.2)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 132)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 130.3)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 130.3)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 126.4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 124.2)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 122.8)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 121.8)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 118.8)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 117.5)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 114.8)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 114.6)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 114.3)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 114.3)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 113.4)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 112.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 112.7)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 111.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 108.9)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 107.6)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 107.6)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 106.5)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 102.2)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 95.4)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 95.4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 89.4)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 89.4)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 89.4)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 87.2)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 85.3)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 83.1)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 82.7)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 82.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 76.8)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 76.8)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 59.8)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 57.2)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 50.3)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 48.8)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 42)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Salvage of nucleosides and nucleotides uridine kinase (TIGR00235; EC 2.7.1.48; HMM-score: 16.3)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA threonylcarbamoyl adenosine modification protein YjeE (TIGR00150; HMM-score: 15.5)
    DNA repair and recombination protein RadB (TIGR02237; HMM-score: 15.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin molybdopterin-guanine dinucleotide biosynthesis protein B (TIGR00176; HMM-score: 14.4)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 14)
    rad50 (TIGR00606; HMM-score: 13.3)
    P-type DNA transfer ATPase VirB11 (TIGR02788; HMM-score: 12.9)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 12.2)
    type IV secretion/conjugal transfer ATPase, VirB4 family (TIGR00929; HMM-score: 12.1)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 11.1)
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 137.5)
    and 33 more
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 46.7)
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 33.6)
    AAA_13; AAA domain (PF13166; HMM-score: 29.8)
    AAA_22; AAA domain (PF13401; HMM-score: 23.5)
    ABC_ATPase; P-loop domain (PF09818; HMM-score: 20.8)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 20.8)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 19.5)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 18.6)
    ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 18.4)
    AAA_14; AAA domain (PF13173; HMM-score: 18.4)
    nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 18.1)
    PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 17)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 16.9)
    TsaE; Threonylcarbamoyl adenosine biosynthesis protein TsaE (PF02367; HMM-score: 16.8)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 16.1)
    AAA_23; AAA domain (PF13476; HMM-score: 16)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 15.5)
    AAA_30; AAA domain (PF13604; HMM-score: 15.5)
    NACHT; NACHT domain (PF05729; HMM-score: 15.1)
    MobB; Molybdopterin guanine dinucleotide synthesis protein B (PF03205; HMM-score: 14.4)
    AAA_19; AAA domain (PF13245; HMM-score: 14.4)
    AAA_24; AAA domain (PF13479; HMM-score: 14.2)
    ORC-CDC6-like; ORC-CDC6-like (PF24389; HMM-score: 14.2)
    AAA_25; AAA domain (PF13481; HMM-score: 13.8)
    PRK; Phosphoribulokinase / Uridine kinase family (PF00485; HMM-score: 13.5)
    HTH (CL0123) DUF3161; Protein of unknown function (DUF3161) (PF11362; HMM-score: 13.5)
    P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 13.2)
    AAA_33; AAA domain (PF13671; HMM-score: 12.6)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 12.4)
    AAA_28; AAA domain (PF13521; HMM-score: 12.4)
    IstB_IS21; IstB-like ATP binding protein (PF01695; HMM-score: 12.2)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 12.2)
    G-alpha; G-protein alpha subunit (PF00503; HMM-score: 12)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.04
    • Cytoplasmic Membrane Score: 9.96
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.1433
    • Cytoplasmic Membrane Score: 0.7915
    • Cell wall & surface Score: 0.0002
    • Extracellular Score: 0.065
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.005078
    • TAT(Tat/SPI): 0.000687
    • LIPO(Sec/SPII): 0.000465
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit | edit source]

  • MIQLNNIHKSFNDVEVIKGIDLSVEQGEVVTLIGRSGSGKTTLLRMINALEIPTEGTVYVNGKTYTSKDKKSQIEVRKQSGMVFQSYNLFPHKTALENVMEGLITVKKLKKDEARGKSLELLEKVGLTHVKDQRPHALSGGQQQRVAIARALAMNPKVMLFDEPTSALDPELVNDVLKVIKDLANEGMTMVIVTHEMRFAKEVSNNIVFIHEGMIGEQGAPEEMFNRPKTEELRRFLNVINEE

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: CymR* (repression) regulon
    CymR*(TF)important in Cysteine metabolism;  regulation predicted or transferred from N315 and NCTC 8325  [2]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
    Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
    Bioinformatics: 2018, 34(23);4118-4120
    [PubMed:29931111] [WorldCat.org] [DOI] (I p)
  2. Hannes Wolfgramm, Larissa Milena Busch, Jöran Tebben, Henry Mehlan, Lisa Hagenau, Thomas Sura, Tilly Hoffmüller, Elisa Bludau, Manuela Gesell Salazar, Alexander Reder, Stephan Michalik, Leif Steil, Kristin Surmann, Ulrike Mäder, Silva Holtfreter, Uwe Völker
    Integrated genomic and proteomic analysis of the mouse-adapted Staphylococcus aureus strain JSNZ.
    Curr Res Microb Sci: 2025, 9;100489
    [PubMed:41146725] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]