Jump to navigation
Jump to search
FunGene: 08-OCT-2024
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: JSNZ_001719
- pan locus tag?: SAUPAN004395000
- symbol: JSNZ_001719
- pan gene symbol?: —
- synonym:
- product: hypothetical protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: JSNZ_001719
- symbol: JSNZ_001719
- product: hypothetical protein
- replicon: chromosome
- strand: +
- coordinates: 1762699..1762788
- length: 90
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61ATGTTGTTAACAACTCCTATAAGATTATATTTAATTGATAATAATTATCAATATCAATTA
TTAGTGTTAATTGTAGCGCATCCCAATTAA60
90
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JSNZ_001719
- symbol: JSNZ_001719
- description: hypothetical protein
- length: 29
- theoretical pI: 7.52782
- theoretical MW: 3443.08
- GRAVY: 0.517241
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED: data available for NCTC8325
- PFAM:
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.32
- Cytoplasmic Membrane Score: 9.55
- Cellwall Score: 0.12
- Extracellular Score: 0.01
- Internal Helices: 0
- DeepLocPro: Cytoplasmic
- Cytoplasmic Score: 0.8169
- Cytoplasmic Membrane Score: 0.0054
- Cell wall & surface Score: 0
- Extracellular Score: 0.1776
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.10159
- TAT(Tat/SPI): 0.005353
- LIPO(Sec/SPII): 0.031456
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
- MLLTTPIRLYLIDNNYQYQLLVLIVAHPN
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator: Fur* (repression) regulon
Fur* (TF) important in Iron homeostasis; regulation predicted or transferred from N315 and NCTC 8325 in Wolfgramm et al. (https://doi.org/10.1101/2025.09.03.674026)
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]