From AureoWiki
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR3757JSNZ04-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

FunGene: 08-OCT-2024

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: JSNZ_000380
  • pan locus tag?: SAUPAN002159000
  • symbol: JSNZ_000380
  • pan gene symbol?: psmα4
  • synonym: psmA4
  • product: phenol-soluble modulin PSM-alpha-4

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: JSNZ_000380
  • symbol: JSNZ_000380
  • product: phenol-soluble modulin PSM-alpha-4
  • replicon: chromosome
  • strand: -
  • coordinates: 411714..411776
  • length: 63
  • essential: unknown

Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq:
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    ATGGCTATTGTAAGTACTATCATTAAAATCATCAAAGCAATTATCGACATTTTCGCAAAA
    TAA
    60
    63

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: JSNZ_000380
  • symbol: JSNZ_000380
  • description: phenol-soluble modulin PSM-alpha-4
  • length: 20
  • theoretical pI: 10.5069
  • theoretical MW: 2201.81
  • GRAVY: 1.68

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:
    no clan defined PSMalpha; Phenol-soluble modulin alpha peptide family (PF17063; HMM-score: 30.9)
    PSMdelta; Phenol-soluble modulin delta protein (PF19693; HMM-score: 25.1)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Extracellular
    • Cytoplasmic Score: 0.24
    • Cytoplasmic Membrane Score: 0.05
    • Cellwall Score: 0.8
    • Extracellular Score: 8.91
    • Internal Helices: 0
  • DeepLocPro: Extracellular
    • Cytoplasmic Score: 0
    • Cytoplasmic Membrane Score: 0.0016
    • Cell wall & surface Score: 0
    • Extracellular Score: 0.9984
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.153568
    • TAT(Tat/SPI): 0.023238
    • LIPO(Sec/SPII): 0.093255
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit | edit source]

  • MAIVSTIIKIIKAIIDIFAK

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator: AgrA (activation) regulon
    AgrA(TF)important in Virulence, Quorum sensing;  transcription unit predicted or transferred from N315 and NCTC8325 

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]

Rong Wang, Kevin R Braughton, Dorothee Kretschmer, Thanh-Huy L Bach, Shu Y Queck, Min Li, Adam D Kennedy, David W Dorward, Seymour J Klebanoff, Andreas Peschel, Frank R DeLeo, Michael Otto
Identification of novel cytolytic peptides as key virulence determinants for community-associated MRSA.
Nat Med: 2007, 13(12);1510-4
[PubMed:17994102] [WorldCat.org] [DOI] (I p)
Michael Otto
Staphylococcus aureus toxins.
Curr Opin Microbiol: 2014, 17;32-7
[PubMed:24581690] [WorldCat.org] [DOI] (I p)