From AureoWiki
Jump to navigation Jump to search

FunGene: 08-OCT-2024

Summary[edit | edit source]

  • organism: Staphylococcus aureus JSNZ
  • locus tag: JSNZ_000163
  • pan locus tag?: SAUPAN001083000
  • symbol: pflA
  • pan gene symbol?: pflA
  • synonym:
  • product: pyruvate formate-lyase-activating protein

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: JSNZ_000163
  • symbol: pflA
  • product: pyruvate formate-lyase-activating protein
  • replicon: chromosome
  • strand: +
  • coordinates: 197797..198552
  • length: 756
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Gene ID:
  • RefSeq:
  • BioCyc:
  • MicrobesOnline:

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    ATGCTTAAGGGACACTTACATTCTGTCGAAAGTTTAGGTACTGTCGATGGACCGGGATTA
    AGATATATATTATTTACACAAGGATGCTTACTTAGATGCTTGTATTGCCACAATCCAGAT
    ACTTGGAAAATTAGTGAGCCATCAAGAGAAGTCACAGTTGATGAAATGGTGAATGAAATA
    TTACCATACAAACCATACTTTGATGCATCGGGTGGCGGTGTAACAGTCAGTGGTGGCGAA
    CCATTGTTACAAATGCCATTCTTAGAAAAATTATTTGCGGAATTAAAAGAAAATGGTGTG
    CACACTTGCTTAGACACATCGGCTGGATGTGCTAATGATACAAAAGCATTTCAAAGGCAT
    TTTGAAGAATTACAAAAACATACAGACTTGATATTATTAGATATAAAACATATTGATAAT
    GACAAACATATTAGATTGACAGGAAAGCCTAATACACACATCCTTAACTTCGCGCGCAAA
    CTGTCAGATATGAAACAACCTGTATGGATTCGACATGTCCTTGTGCCTGGTTATTCTGAT
    GATAAAGACGATTTAATTAAACTAGGGGAATTCATTAATTCTCTTGATAACGTCGAAAAG
    TTTGAAATTCTGCCATATCATCAGTTAGGTGTTCATAAGTGGAAAACATTGGGCATTGCA
    TATGAATTAGAAGATGTCGAAGCGCCCGATGATGAAGCTGTTAAAGCAGCCTACCGTTAT
    GTTAACTTCAAAGGGAAAATTCCCGTTGAATTATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    756

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: JSNZ_000163
  • symbol: PflA
  • description: pyruvate formate-lyase-activating protein
  • length: 251
  • theoretical pI: 5.9116
  • theoretical MW: 28498.4
  • GRAVY: -0.319124

Function[edit | edit source]

  • reaction:
    EC 1.97.1.4?  ExPASy
    [Formate-C-acetyltransferase]-activating enzyme S-adenosyl-L-methionine + dihydroflavodoxin + [formate C-acetyltransferase]-glycine = 5'-deoxyadenosine + L-methionine + flavodoxin semiquinone + [formate C-acetyltransferase]-glycin-2-yl radical
  • TIGRFAM:
    Genetic information processing Protein fate Protein modification and repair pyruvate formate-lyase 1-activating enzyme (TIGR02493; EC 1.97.1.4; HMM-score: 320.7)
    Metabolism Energy metabolism Anaerobic pyruvate formate-lyase 1-activating enzyme (TIGR02493; EC 1.97.1.4; HMM-score: 320.7)
    and 30 more
    glycyl-radical enzyme activating protein (TIGR02494; EC 1.97.1.-; HMM-score: 195.8)
    Metabolism Energy metabolism Amino acids and amines choline TMA-lyase-activating enzyme (TIGR04395; EC 1.97.-.-; HMM-score: 154.8)
    Genetic information processing Protein fate Protein modification and repair glycine radical enzyme activase, YjjW family (TIGR04041; EC 1.97.1.-; HMM-score: 133.4)
    Genetic information processing Protein fate Protein modification and repair [benzylsuccinate synthase]-activating enzyme (TIGR04003; EC 1.97.-.-; HMM-score: 127.2)
    Genetic information processing Protein fate Protein modification and repair anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 64.4)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides 2'-Deoxyribonucleotide metabolism anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02495; EC 1.97.-.-; HMM-score: 64.4)
    Genetic information processing Protein fate Protein modification and repair anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02491; EC 1.97.1.-; HMM-score: 55)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides 2'-Deoxyribonucleotide metabolism anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02491; EC 1.97.1.-; HMM-score: 55)
    His-Xaa-Ser system radical SAM maturase HxsC (TIGR03977; HMM-score: 33.6)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other coenzyme PQQ biosynthesis enzyme PqqE (TIGR02109; HMM-score: 30)
    putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR04349; HMM-score: 29.3)
    radical SAM protein, TatD family-associated (TIGR04038; HMM-score: 29.1)
    Genetic information processing Protein synthesis tRNA and rRNA base modification 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR03365; HMM-score: 25.7)
    Genetic information processing Protein synthesis tRNA and rRNA base modification putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR03963; HMM-score: 25.6)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides 2'-Deoxyribonucleotide metabolism anaerobic ribonucleoside-triphosphate reductase activating protein (TIGR02826; EC 1.97.1.-; HMM-score: 25)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin molybdenum cofactor biosynthesis protein A (TIGR02666; HMM-score: 24.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Molybdopterin probable molybdenum cofactor biosynthesis protein A (TIGR02668; HMM-score: 22.1)
    AmmeMemoRadiSam system radical SAM enzyme (TIGR04337; HMM-score: 21.9)
    putative 7-cyano-7-deazaguanosine (preQ0) biosynthesis protein QueE (TIGR04322; HMM-score: 17.1)
    SynChlorMet cassette radical SAM/SPASM protein ScmF (TIGR04251; HMM-score: 16.5)
    putative peptide-modifying radical SAM enzyme, Mhun_1560 family (TIGR04083; HMM-score: 15.6)
    Signal transduction Regulatory functions Protein interactions peptide modification radical SAM enzyme, YydG family (TIGR04078; HMM-score: 14.9)
    Cellular processes Cellular processes Toxin production and resistance Cys-rich peptide radical SAM maturase CcpM (TIGR04068; HMM-score: 14.6)
    radical SAM peptide maturase, GG-Bacteroidales family (TIGR04148; HMM-score: 14.6)
    putative geopeptide radical SAM maturase (TIGR04280; HMM-score: 14.1)
    radical SAM peptide maturase, CXXX-repeat target family (TIGR04115; HMM-score: 13.4)
    Cellular processes Cellular processes Toxin production and resistance tryptophan 2-C-methyltransferase (TIGR04428; EC 2.1.1.106; HMM-score: 12.1)
    SynChlorMet cassette radical SAM/SPASM protein ScmE (TIGR04250; HMM-score: 12)
    His-Xaa-Ser system radical SAM maturase HxsB (TIGR03978; HMM-score: 10.5)
    Cellular processes Cellular processes Toxin production and resistance nif11-like peptide radical SAM maturase (TIGR04064; HMM-score: 9.6)
  • TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
  • PFAM:
    TIM_barrel (CL0036) Radical_SAM; Radical SAM superfamily (PF04055; HMM-score: 86.6)
    and 1 more
    4Fe-4S (CL0344) Fer4_12; 4Fe-4S single cluster domain (PF13353; HMM-score: 62)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic
    • Cytoplasmic Score: 0.9864
    • Cytoplasmic Membrane Score: 0.0056
    • Cell wall & surface Score: 0.0001
    • Extracellular Score: 0.008
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.04507
    • TAT(Tat/SPI): 0.001294
    • LIPO(Sec/SPII): 0.124693
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit | edit source]

  • MLKGHLHSVESLGTVDGPGLRYILFTQGCLLRCLYCHNPDTWKISEPSREVTVDEMVNEILPYKPYFDASGGGVTVSGGEPLLQMPFLEKLFAELKENGVHTCLDTSAGCANDTKAFQRHFEELQKHTDLILLDIKHIDNDKHIRLTGKPNTHILNFARKLSDMKQPVWIRHVLVPGYSDDKDDLIKLGEFINSLDNVEKFEILPYHQLGVHKWKTLGIAYELEDVEAPDDEAVKAAYRYVNFKGKIPVEL

Experimental data[edit | edit source]

  • experimentally validated: data available for NCTC8325
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulators: Rex* (repression) regulon, ArcR* (activation) regulon, CcpA regulon
    Rex*(TF)important in Energy metabolism;  regulation predicted or transferred from N315 and NCTC 8325  [2]
    ArcR*(TF)important in Arginine degradation;  regulation predicted or transferred from N315 and NCTC 8325  [2]
    CcpA(TF)important in Carbon catabolism;  regulation predicted or transferred from N315 and NCTC 8325  [2]

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You can add further information about the gene and protein here. [edit]

Literature[edit | edit source]

References[edit | edit source]

  1. Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
    Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
    Bioinformatics: 2018, 34(23);4118-4120
    [PubMed:29931111] [WorldCat.org] [DOI] (I p)
  2. 2.0 2.1 2.2 Hannes Wolfgramm, Larissa Milena Busch, Jöran Tebben, Henry Mehlan, Lisa Hagenau, Thomas Sura, Tilly Hoffmüller, Elisa Bludau, Manuela Gesell Salazar, Alexander Reder, Stephan Michalik, Leif Steil, Kristin Surmann, Ulrike Mäder, Silva Holtfreter, Uwe Völker
    Integrated genomic and proteomic analysis of the mouse-adapted Staphylococcus aureus strain JSNZ.
    Curr Res Microb Sci: 2025, 9;100489
    [PubMed:41146725] [WorldCat.org] [DOI] (I e)

Relevant publications[edit | edit source]