Jump to navigation
Jump to search
FunGene: 08-OCT-2024
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: JSNZ_000150
- pan locus tag?: SAUPAN001064000
- symbol: JSNZ_000150
- pan gene symbol?: malK
- synonym:
- product: ABC transporter ATP-binding protein
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: CDS
- locus tag: JSNZ_000150
- symbol: JSNZ_000150
- product: ABC transporter ATP-binding protein
- replicon: chromosome
- strand: +
- coordinates: 181108..182205
- length: 1098
- essential: unknown other strains
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081ATGGCAGAACTAAAGTTAGAGCATATTAAAAAGACGTATGATAACAACAATACTGTAGTG
AAAGATTTTAATCTACATATTACTGACAAAGAATTCATTGTATTTGTTGGACCATCGGGA
TGTGGTAAATCAACAACATTACGAATGGTTGCTGGACTAGAGTCTATCACATCTGGAGAT
TTTTATATTGATGGGGAACGCATGAACGATGTTGAACCAAAGAATAGAGATATTGCGATG
GTATTTCAAAACTATGCATTATATCCACATATGACTGTATTTGAAAATATGGCATTTGGG
CTAAAGCTACGTAAAGTAAATAAAAAAGAGATTGAACAAAAAGTCAATGAAGCAGCTGAA
ATATTAGGATTAACTGAGTATCTTGGTCGTAAACCAAAAGCGTTATCTGGTGGACAGCGT
CAACGTGTTGCTTTGGGCAGAGCTATTGTTAGGGATGCGAAAGTCTTTTTAATGGATGAA
CCATTATCGAATCTTGATGCGAAGCTTCGAGTACAAATGCGCACAGAAATATTGAAATTA
CATAAGCGACTTAATACTACGACAATTTATGTTACACATGATCAAACTGAAGCATTGACG
ATGGCTAGTCGAATTGTTGTTTTGAAAGATGGCGACATTATGCAAGTCGGCACACCTAGA
GAAATATATGATGCCCCTAATTGCATATTTGTGGCGCAATTTATCGGCTCACCAGCAATG
AATATGTTGAATGCTACAGTTGAAATGGACGGATTGAAGGTAGGAACACATCATTTTAAA
TTACATAATAAAAAATTTGAAAAGTTAAAAGCTGCTGGCTACTTAGACAAGGAAATTATT
TTAGGTATTCGAGCTGAAGACATTCATGAAGAACCAATATTTATTCAAACTTCTCCAGAG
ACACAATTTGAATCTGAAGTAGTTGTATCCGAACTGTTAGGTTCAGAAATTATGGTACAT
AGCACATTCCAAGGAATGGAATTGATTTCTAAATTAGATTCAAGAACACAAGTGATGGCG
AACGACAAGATTACACTAGCATTTGATATGAATAAGTGTCACTTTTTTGATGAAAAAACA
GGAAATCGTATCGTCTAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
1080
1098
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: JSNZ_000150
- symbol: JSNZ_000150
- description: ABC transporter ATP-binding protein
- length: 365
- theoretical pI: 6.91775
- theoretical MW: 41334.6
- GRAVY: -0.243288
⊟Function[edit | edit source]
- TIGRFAM: Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 327.1)Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 310)Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 263)2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 261.8)and 70 moreTransport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 240.1)Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 205.9)Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 184.4)Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 174.9)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 174.8)Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 163.5)Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 161)Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 159.7)Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 159.7)Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 151.7)Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 151.7)Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 149.8)Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 144.9)D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 144)ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 142.3)Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 137.3)ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 135.5)Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 132.3)thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 130.6)Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 126.9)ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 124)Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 123.9)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 123.9)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 123)Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 123)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 120.4)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 120.4)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 119.6)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 119.5)Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 115.4)Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 115.4)Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 106.9)Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 106.9)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 106.5)Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 105.7)Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 105.7)Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 105.1)thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 103.2)Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 102.2)Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 102)Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 101.5)Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 101.5)gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 100.3)proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 99.5)lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 99.1)Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 98.9)Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 98.9)Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 98.9)Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 96.5)Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 83.4)Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 81.6)Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 81.6)Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 77.3)Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 76.4)Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 75.6)Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 69.6)phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 68.7)ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 67.3)Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 66.5)Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 66.5)Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 64.2)Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 54.5)Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 51.8)Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 50.5)Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 49.3)Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 38)DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 34.1)Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 17)DNA metabolism DNA replication, recombination, and repair checkpoint protein rad24 (TIGR00602; HMM-score: 15.3)Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 12.8)
- TheSEED: data available for COL, N315, NCTC8325, Newman, USA300_FPR3757
- PFAM: P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 112.2)and 24 moreOB (CL0021) OB_MalK; MalK OB fold domain (PF17912; HMM-score: 50.2)TOBE; TOBE domain (PF03459; HMM-score: 46)P-loop_NTPase (CL0023) SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 25.5)Rad17; Rad17 P-loop domain (PF03215; HMM-score: 24.1)OB (CL0021) TOBE_2; TOBE domain (PF08402; HMM-score: 23.3)P-loop_NTPase (CL0023) AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 23)AAA_22; AAA domain (PF13401; HMM-score: 19.4)RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 16.8)OB (CL0021) CysA_C_terminal; CysA C-terminal regulatory domain (PF17850; HMM-score: 15.8)P-loop_NTPase (CL0023) AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 15.1)nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 14.9)AAA_23; AAA domain (PF13476; HMM-score: 14.7)AAA_28; AAA domain (PF13521; HMM-score: 14.3)bpMoxR; MoxR domain in the MoxR-vWA-beta-propeller ternary systems (PF20030; HMM-score: 13.8)ATPase_2; ATPase domain predominantly from Archaea (PF01637; HMM-score: 13.3)AAA_14; AAA domain (PF13173; HMM-score: 13)nSTAND1; Novel STAND NTPase 1 (PF20703; HMM-score: 13)RNA_helicase; RNA helicase (PF00910; HMM-score: 12.9)AAA_18; AAA domain (PF13238; HMM-score: 12.8)AAA_33; AAA domain (PF13671; HMM-score: 12.8)AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 12.5)AAA_15; AAA ATPase domain (PF13175; HMM-score: 12.3)ORC-CDC6-like; ORC-CDC6-like (PF24389; HMM-score: 11.9)no clan defined ProRS-C_2; Prolyl-tRNA synthetase, C-terminal (PF09181; HMM-score: 11)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic Membrane
- Cytoplasmic Score: 0.04
- Cytoplasmic Membrane Score: 9.96
- Cellwall Score: 0
- Extracellular Score: 0
- Internal Helices: 0
- DeepLocPro: Cytoplasmic Membrane
- Cytoplasmic Score: 0.3697
- Cytoplasmic Membrane Score: 0.512
- Cell wall & surface Score: 0.0001
- Extracellular Score: 0.1181
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.008572
- TAT(Tat/SPI): 0.001234
- LIPO(Sec/SPII): 0.004169
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
- MAELKLEHIKKTYDNNNTVVKDFNLHITDKEFIVFVGPSGCGKSTTLRMVAGLESITSGDFYIDGERMNDVEPKNRDIAMVFQNYALYPHMTVFENMAFGLKLRKVNKKEIEQKVNEAAEILGLTEYLGRKPKALSGGQRQRVALGRAIVRDAKVFLMDEPLSNLDAKLRVQMRTEILKLHKRLNTTTIYVTHDQTEALTMASRIVVLKDGDIMQVGTPREIYDAPNCIFVAQFIGSPAMNMLNATVEMDGLKVGTHHFKLHNKKFEKLKAAGYLDKEIILGIRAEDIHEEPIFIQTSPETQFESEVVVSELLGSEIMVHSTFQGMELISKLDSRTQVMANDKITLAFDMNKCHFFDEKTGNRIV
⊟Experimental data[edit | edit source]
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- Operon-mapper [1] : JSNZ_000150 > JSNZ_000151 > JSNZ_000152 > JSNZ_000153
⊟Regulation[edit | edit source]
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ Blanca Taboada, Karel Estrada, Ricardo Ciria, Enrique Merino
Operon-mapper: a web server for precise operon identification in bacterial and archaeal genomes.
Bioinformatics: 2018, 34(23);4118-4120
[PubMed:29931111] [WorldCat.org] [DOI] (I p) - ↑ 2.0 2.1 Hannes Wolfgramm, Larissa Milena Busch, Jöran Tebben, Henry Mehlan, Lisa Hagenau, Thomas Sura, Tilly Hoffmüller, Elisa Bludau, Manuela Gesell Salazar, Alexander Reder, Stephan Michalik, Leif Steil, Kristin Surmann, Ulrike Mäder, Silva Holtfreter, Uwe Völker
Integrated genomic and proteomic analysis of the mouse-adapted Staphylococcus aureus strain JSNZ.
Curr Res Microb Sci: 2025, 9;100489
[PubMed:41146725] [WorldCat.org] [DOI] (I e)