Jump to navigation
Jump to search
NCBI: 01-DEC-2025
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus JSNZ
- locus tag: EGJ38_002130 [new locus tag: EGJ38_RS10630 ]
- pan locus tag?: SAUPAN005524000
- symbol: trnaN
- pan gene symbol?: trnaN
- synonym:
- product: tRNA-Asn
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: tRNA
- locus tag: EGJ38_002130 [new locus tag: EGJ38_RS10630 ]
- symbol: trnaN
- product: tRNA-Asn
- replicon: chromosome
- strand: -
- coordinates: 2145485..2145559
- length: 75
- essential: unknown
⊟Accession numbers[edit | edit source]
- Gene ID:
- RefSeq:
- BioCyc:
- MicrobesOnline:
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61TCCACAGTAGCTCAGTGGTAGAGCTATCGGCTGTTAACCGATCGGTCGTAGGTTCGAGTC
CTACCTGTGGAGCCA60
75
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: EGJ38_002130 [new locus tag: EGJ38_RS10630 ]
- symbol: TrnaN
- description: tRNA-Asn
- length:
- theoretical pI:
- theoretical MW:
- GRAVY:
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED:
- PFAM:
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb:
- DeepLocPro:
- LocateP:
- SignalP:
- predicted transmembrane helices (TMHMM):
⊟Accession numbers[edit | edit source]
- GI:
- RefSeq:
- UniProt:
⊟Protein sequence[edit | edit source]
⊟Experimental data[edit | edit source]
- experimentally validated:
- protein localization:
- quantitative data / protein copy number per cell:
- interaction partners:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You can add further information about the gene and protein here. [edit]