From AureoWiki
Jump to navigation Jump to search
m (Text replacement - "gene Genbank" to "gene RefSeq")
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
 
Line 1: Line 1:
__TOC__
<protect>
<protect>
<aureodatabase>NCBI date</aureodatabase>
<aureodatabase>annotation</aureodatabase>


=Summary=
=Summary=


* <aureodatabase>organism</aureodatabase>
*<aureodatabase>organism</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>pan locus</aureodatabase>
*<aureodatabase>pan locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>pan gene symbol</aureodatabase>
*<aureodatabase>pan gene symbol</aureodatabase>
* <aureodatabase>gene synonyms</aureodatabase>
*<aureodatabase>gene synonyms</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
</protect>
</protect>


Line 24: Line 25:
==General==
==General==


* <aureodatabase>gene type</aureodatabase>
*<aureodatabase>gene type</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
* <aureodatabase>gene replicon</aureodatabase>
*<aureodatabase>gene replicon</aureodatabase>
* <aureodatabase>strand</aureodatabase>
*<aureodatabase>strand</aureodatabase>
* <aureodatabase>gene coordinates</aureodatabase>
*<aureodatabase>gene coordinates</aureodatabase>
* <aureodatabase>gene length</aureodatabase>
*<aureodatabase>gene length</aureodatabase>
* <aureodatabase>essential</aureodatabase>
*<aureodatabase>essential</aureodatabase>
*<aureodatabase>gene comment</aureodatabase>
</protect>
</protect>


Line 38: Line 40:
==Accession numbers==
==Accession numbers==


* <aureodatabase>gene GI</aureodatabase>
*<aureodatabase>gene GI</aureodatabase>
* <aureodatabase>gene RefSeq</aureodatabase>
*<aureodatabase>gene RefSeq</aureodatabase>
*<aureodatabase>gene BioCyc</aureodatabase>
*<aureodatabase>gene MicrobesOnline</aureodatabase>
</protect>
</protect>
   
   
<protect>  
<protect>
==Phenotype==
==Phenotype==
</protect>
</protect>
* Share your knowledge and add information here. [<span class="plainlinks">[http://www.protecs.uni-greifswald.de/aureowiki/index.php?title={{PAGENAMEE}}&action=edit&section=6 edit]</span>]
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit&section=6 edit]</span>]


<protect>
<protect>
==DNA sequence==
==DNA sequence==


* <aureodatabase>gene sequence</aureodatabase>
*<aureodatabase>gene sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
<aureodatabase>RNA regulated operons</aureodatabase>
</protect>


<protect>
=Protein=
=Protein=
<aureodatabase>protein 3D view</aureodatabase>
<aureodatabase>protein 3D view</aureodatabase>
==General==
==General==


* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>protein symbol</aureodatabase>
*<aureodatabase>protein symbol</aureodatabase>
* <aureodatabase>protein description</aureodatabase>
*<aureodatabase>protein description</aureodatabase>
* <aureodatabase>protein length</aureodatabase>
*<aureodatabase>protein length</aureodatabase>
* <aureodatabase>theoretical pI</aureodatabase>
*<aureodatabase>theoretical pI</aureodatabase>
* <aureodatabase>theoretical MW</aureodatabase>
*<aureodatabase>theoretical MW</aureodatabase>
* <aureodatabase>GRAVY</aureodatabase>
*<aureodatabase>GRAVY</aureodatabase>
</protect>
</protect>


Line 71: Line 78:
==Function==
==Function==


* <aureodatabase>protein reaction</aureodatabase>
*<aureodatabase>protein reaction</aureodatabase>
* <aureodatabase>protein TIGRFAM</aureodatabase>
*<aureodatabase>protein TIGRFAM</aureodatabase>
* <aureodatabase>protein TheSeed</aureodatabase>
*<aureodatabase>protein TheSeed</aureodatabase>
* <aureodatabase>protein PFAM</aureodatabase>
*<aureodatabase>protein PFAM</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Structure, modifications & interactions==
==Structure, modifications & cofactors==


* <aureodatabase>protein domains</aureodatabase>
*<aureodatabase>protein domains</aureodatabase>
* <aureodatabase>protein modifications</aureodatabase>
*<aureodatabase>protein modifications</aureodatabase>
* <aureodatabase>protein cofactors</aureodatabase>
*<aureodatabase>protein cofactors</aureodatabase>
* <aureodatabase>protein effectors</aureodatabase>
*<aureodatabase>protein effectors</aureodatabase>
* <aureodatabase>protein partners</aureodatabase>
*<aureodatabase>protein regulated operons</aureodatabase>
</protect>
</protect>


Line 90: Line 97:
==Localization==
==Localization==


* <aureodatabase>protein Psortb</aureodatabase>
*<aureodatabase>protein Psortb</aureodatabase>
* <aureodatabase>protein LocateP</aureodatabase>
*<aureodatabase>protein LocateP</aureodatabase>
* <aureodatabase>protein SignalP</aureodatabase>
*<aureodatabase>protein SignalP</aureodatabase>
* <aureodatabase>protein TMHMM</aureodatabase>
*<aureodatabase>protein TMHMM</aureodatabase>
</protect>
</protect>


Line 99: Line 106:
==Accession numbers==
==Accession numbers==


* <aureodatabase>protein GI</aureodatabase>
*<aureodatabase>protein GI</aureodatabase>
* <aureodatabase>protein UniProt</aureodatabase>
*<aureodatabase>protein RefSeq</aureodatabase>
* <aureodatabase>protein Genbank</aureodatabase>
*<aureodatabase>protein UniProt</aureodatabase>
* <aureodatabase>protein RefSeq</aureodatabase>
</protect>
</protect>


Line 108: Line 114:
==Protein sequence==
==Protein sequence==


* <aureodatabase>protein sequence</aureodatabase>
*<aureodatabase>protein sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Peptides==
==Experimental data==


* <aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated localization</aureodatabase>
*<aureodatabase>protein validated quantitative data</aureodatabase>
*<aureodatabase>protein partners</aureodatabase>
</protect>
</protect>


Line 125: Line 134:
==Operon==
==Operon==


* <aureodatabase>operons</aureodatabase>
*<aureodatabase>operons</aureodatabase>
</protect>
</protect>


Line 131: Line 140:
==Regulation==
==Regulation==


* <aureodatabase>sigma factors</aureodatabase>
*<aureodatabase>regulators</aureodatabase>
* <aureodatabase>regulators</aureodatabase>
</protect>
</protect>


Line 138: Line 146:
==Transcription pattern==
==Transcription pattern==


* <aureodatabase>expression browser</aureodatabase>
*<aureodatabase>expression browser</aureodatabase>
</protect>
</protect>


Line 144: Line 152:
==Protein synthesis (provided by Aureolib)==
==Protein synthesis (provided by Aureolib)==


* <aureodatabase>protein synthesis Aureolib</aureodatabase>
*<aureodatabase>protein synthesis Aureolib</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Stability==
==Protein stability==


* <aureodatabase>protein half-life</aureodatabase>
*<aureodatabase>protein half-life</aureodatabase>
</protect>
</protect>



Latest revision as of 05:14, 11 March 2016

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1290 [new locus tag: SACOL_RS06585 ]
  • pan locus tag?: SAUPAN003572000
  • symbol: truB
  • pan gene symbol?: truB
  • synonym:
  • product: tRNA pseudouridine synthase B

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1290 [new locus tag: SACOL_RS06585 ]
  • symbol: truB
  • product: tRNA pseudouridine synthase B
  • replicon: chromosome
  • strand: +
  • coordinates: 1303208..1304125
  • length: 918
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    ATGTATAATGGGATATTACCAGTATATAAAGAGCGCGGTTTAACAAGTCATGACGTTGTA
    TTCAAATTGCGTAAAATATTAAAAACTAAAAAAATAGGTCACACGGGTACGCTTGATCCC
    GAAGTTGCAGGCGTGTTACCGGTATGTATAGGTAATGCAACGAGAGTTAGTGATTATGTT
    ATGGATATGGGCAAAGCTTATGAAGCAACTGTATCGATAGGAAGAAGTACAACGACTGAA
    GATCAAACGGGTGATACATTGGAAACAAAAGGTGTACACTCAGCAGATTTTAATAAGGAC
    GATATTGACCGATTGTTAGAAAGTTTTAAAGGTATCATTGAACAAATTCCGCCGATGTAC
    TCATCCGTCAAAGTAAATGGTAAAAAATTATATGAATATGCGCGTAATAATGAAACAGTT
    GAAAGACCAAAGCGTAAAGTTAATATTAAAGACATTGGGCGTATATCTGAATTAGATTTT
    AAAGAAAATGAGTGTCATTTTAAAATACGCGTCATCTGTGGTAAAGGTACATATATTAGA
    ACGCTAGCAACTGATATTGGTGTGAAATTAGGCTTTCCGGCACATATGTCGAAATTAACA
    CGAATCGAGTCTGGTGGATTTGTGTTGAAAGATAGCCTTACATTAGAACAAATAAAAGAA
    CTTCATGAGCAGGATTCATTGCAAAATAAATTGTTTCCTTTAGAATATGGATTAAAGGGT
    TTGCCAAGCATTAAAATTAAAGATTCGCACATAAAAAAACGTATTTTAAATGGGCAGAAA
    TTTAATAAAAATGAATTTGATAACAAAATTAAAGACCAAATTGTATTTATTGATGATGAT
    TCAGAAAAAGTATTAGCAATTTATATGGTACACCCTACAAAAGAATCAGAAATTAAACCT
    AAAAAAGTCTTTAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    918

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL1290 [new locus tag: SACOL_RS06585 ]
  • symbol: TruB
  • description: tRNA pseudouridine synthase B
  • length: 305
  • theoretical pI: 9.56269
  • theoretical MW: 34592.7
  • GRAVY: -0.48918

Function[edit | edit source]

  • reaction:
    EC 4.2.1.70?  ExPASy
    Pseudouridylate synthase Uracil + D-ribose 5-phosphate = pseudouridine 5'-phosphate + H2O
    EC 5.4.99.25?  ExPASy
    tRNA pseudouridine55 synthase tRNA uridine55 = tRNA pseudouridine55
  • TIGRFAM:
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA pseudouridine(55) synthase (TIGR00431; EC 5.4.99.25; HMM-score: 249)
    and 2 more
    Genetic information processing Protein synthesis tRNA and rRNA base modification putative rRNA pseudouridine synthase (TIGR00425; EC 5.4.99.-; HMM-score: 134.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds tonB-system energizer ExbB (TIGR02805; HMM-score: 11.8)
  • TheSEED  :
    • tRNA pseudouridine synthase B (EC 4.2.1.70)
    RNA Metabolism RNA processing and modification tRNA processing  tRNA pseudouridine synthase B (EC 4.2.1.70)
  • PFAM:
    PseudoU_synth (CL0649) TruB_N; TruB family pseudouridylate synthase (N terminal domain) (PF01509; HMM-score: 183.2)
    and 1 more
    TruB_C_2; tRNA pseudouridylate synthase B C-terminal domain (PF16198; HMM-score: 47)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.007617
    • TAT(Tat/SPI): 0.000587
    • LIPO(Sec/SPII): 0.000837
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MYNGILPVYKERGLTSHDVVFKLRKILKTKKIGHTGTLDPEVAGVLPVCIGNATRVSDYVMDMGKAYEATVSIGRSTTTEDQTGDTLETKGVHSADFNKDDIDRLLESFKGIIEQIPPMYSSVKVNGKKLYEYARNNETVERPKRKVNIKDIGRISELDFKENECHFKIRVICGKGTYIRTLATDIGVKLGFPAHMSKLTRIESGGFVLKDSLTLEQIKELHEQDSLQNKLFPLEYGLKGLPSIKIKDSHIKKRILNGQKFNKNEFDNKIKDQIVFIDDDSEKVLAIYMVHPTKESEIKPKKVFN

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3]
  • quantitative data / protein copy number per cell: 195 [4]
  • interaction partners:
    SACOL1215(carB)carbamoyl phosphate synthase large subunit  [5] (data from MRSA252)
    SACOL1016(fabI)enoyl-ACP reductase  [5] (data from MRSA252)
    SACOL1072(folD)bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase  [5] (data from MRSA252)
    SACOL1199(ftsZ)cell division protein FtsZ  [5] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [5] (data from MRSA252)
    SACOL1922(hemL2)glutamate-1-semialdehyde aminotransferase  [5] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [5] (data from MRSA252)
    SACOL1477(ilvA1)threonine dehydratase  [5] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [5] (data from MRSA252)
    SACOL2092(murAA)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [5] (data from MRSA252)
    SACOL2116(murAB)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [5] (data from MRSA252)
    SACOL0792(nrdE)ribonucleotide-diphosphate reductase subunit alpha  [5] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [5] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [5] (data from MRSA252)
    SACOL2128(pdp)pyrimidine-nucleoside phosphorylase  [5] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [5] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [5] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [5] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [5] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [5] (data from MRSA252)
    SACOL0626(thiD1)phosphomethylpyrimidine kinase  [5] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [5] (data from MRSA252)
    SACOL0435GTP-dependent nucleic acid-binding protein EngD  [5] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [5] (data from MRSA252)
    SACOL0973fumarylacetoacetate hydrolase  [5] (data from MRSA252)
    SACOL1759universal stress protein  [5] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [5] (data from MRSA252)
    SACOL2561hydroxymethylglutaryl-CoA synthase  [5] (data from MRSA252)

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator: SigB* (activation) regulon
    SigB*(sigma factor)controlling a large regulon involved in stress/starvation response and adaptation [6]   other strains

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 32.96 h [7]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  5. 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 5.15 5.16 5.17 5.18 5.19 5.20 5.21 5.22 5.23 5.24 5.25 5.26 5.27 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  6. Markus Bischoff, Paul Dunman, Jan Kormanec, Daphne Macapagal, Ellen Murphy, William Mounts, Brigitte Berger-Bächi, Steven Projan
    Microarray-based analysis of the Staphylococcus aureus sigmaB regulon.
    J Bacteriol: 2004, 186(13);4085-99
    [PubMed:15205410] [WorldCat.org] [DOI] (P p)
  7. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]