From AureoWiki
Revision as of 08:54, 11 March 2016 by AureoSysAdmin (talk | contribs) (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL1221 [new locus tag: SACOL_RS06255 ]
  • pan locus tag?: SAUPAN003491000
  • symbol: gmk
  • pan gene symbol?: gmk
  • synonym:
  • product: guanylate kinase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL1221 [new locus tag: SACOL_RS06255 ]
  • symbol: gmk
  • product: guanylate kinase
  • replicon: chromosome
  • strand: +
  • coordinates: 1230617..1231240
  • length: 624
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    ATGGATAATGAAAAAGGATTGTTAATCGTTTTATCAGGACCATCTGGAGTAGGTAAAGGT
    ACTGTTAGAAAACGAATATTTGAAGATCCAAGTACATCATATAAGTATTCTATTTCAATG
    ACAACACGTCAAATGCGTGAAGGTGAAGTTGATGGCGTAGATTACTTTTTTAAAACTAGG
    GATGCGTTTGAAGCTTTAATCAAAGATGACCAATTTATAGAATATGCTGAATATGTAGGC
    AACTATTATGGTACACCAGTTCAATATGTTAAAGATACAATGGACGAAGGTCATGATGTA
    TTTTTAGAAATTGAAGTAGAAGGTGCAAAGCAAGTTAGAAAGAAATTTCCAGATGCGCTA
    TTTATTTTCTTAGCACCTCCAAGTTTAGAACACTTGAGAGAGCGATTAGTAGGTAGAGGA
    ACAGAATCTGATGAGAAAATACAAAGTCGTATTAACGAAGCGCGTAAAGAAGTTGAAATG
    ATGAATTTATACGATTACGTTGTAGTTAATGATGAAGTAGAACTTGCGAAGAATAGAATT
    CAATGTATTGTAGAAGCTGAGCACTTAAAAAGAGAGCGCGTAGAAGCTAAGTATAGAAAA
    ATGATTTTGGAGGCTAAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    624

Protein[edit | edit source]

Protein Data Bank: 2J41

General[edit | edit source]

  • locus tag: SACOL1221 [new locus tag: SACOL_RS06255 ]
  • symbol: Gmk
  • description: guanylate kinase
  • length: 207
  • theoretical pI: 5.10267
  • theoretical MW: 24037.2
  • GRAVY: -0.579227

Function[edit | edit source]

  • reaction:
    EC 2.7.4.8?  ExPASy
    Guanylate kinase ATP + GMP = ADP + GDP
  • TIGRFAM:
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions guanylate kinase (TIGR03263; EC 2.7.4.8; HMM-score: 238.9)
    and 5 more
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate metabolism protein/1,5-bisphosphokinase (PRPP-forming) PhnN (TIGR02322; HMM-score: 47.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Pantothenate and coenzyme A dephospho-CoA kinase (TIGR00152; EC 2.7.1.24; HMM-score: 19)
    putative cytidylate kinase (TIGR02173; EC 2.7.4.14; HMM-score: 14.1)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions adenylate kinase (TIGR01351; EC 2.7.4.-; HMM-score: 13.5)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 12.4)
  • TheSEED  :
    • Guanylate kinase (EC 2.7.4.8)
    Nucleosides and Nucleotides Purines Purine conversions  Guanylate kinase (EC 2.7.4.8)
  • PFAM:
    P-loop_NTPase (CL0023) Guanylate_kin; Guanylate kinase (PF00625; HMM-score: 172.1)
    and 9 more
    AAA_18; AAA domain (PF13238; HMM-score: 19.7)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 14.3)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 14.3)
    AAA_17; AAA domain (PF13207; HMM-score: 14.1)
    AAA_22; AAA domain (PF13401; HMM-score: 14.1)
    AAA_33; AAA domain (PF13671; HMM-score: 13.8)
    ABC_tran; ABC transporter (PF00005; HMM-score: 13.6)
    no clan defined YtxH; YtxH-like protein (PF12732; HMM-score: 13.2)
    P-loop_NTPase (CL0023) RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 11.9)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.006276
    • TAT(Tat/SPI): 0.000768
    • LIPO(Sec/SPII): 0.002138
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MDNEKGLLIVLSGPSGVGKGTVRKRIFEDPSTSYKYSISMTTRQMREGEVDGVDYFFKTRDAFEALIKDDQFIEYAEYVGNYYGTPVQYVKDTMDEGHDVFLEIEVEGAKQVRKKFPDALFIFLAPPSLEHLRERLVGRGTESDEKIQSRINEARKEVEMMNLYDYVVVNDEVELAKNRIQCIVEAEHLKRERVEAKYRKMILEAKK

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1] [2] [3]
  • quantitative data / protein copy number per cell: 621 [4]
  • interaction partners:
    SACOL0842(eno)phosphopyruvate hydratase  [5] (data from MRSA252)
    SACOL1245(fabG1)3-oxoacyl-ACP reductase  [5] (data from MRSA252)
    SACOL2117(fbaA)fructose-bisphosphate aldolase  [5] (data from MRSA252)
    SACOL1329(femC)glutamine synthetase  [5] (data from MRSA252)
    SACOL1072(folD)bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/ 5,10-methylene-tetrahydrofolate cyclohydrolase  [5] (data from MRSA252)
    SACOL1199(ftsZ)cell division protein FtsZ  [5] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [5] (data from MRSA252)
    SACOL1622(glyS)glycyl-tRNA synthetase  [5] (data from MRSA252)
    SACOL2016(groEL)chaperonin GroEL  [5] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [5] (data from MRSA252)
    SACOL1206(ileS)isoleucyl-tRNA synthetase  [5] (data from MRSA252)
    SACOL0222(ldh1)L-lactate dehydrogenase  [5] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [5] (data from MRSA252)
    SACOL1005(pepF)oligoendopeptidase F  [5] (data from MRSA252)
    SACOL0966(pgi)glucose-6-phosphate isomerase  [5] (data from MRSA252)
    SACOL0841(pgm)phosphoglyceromutase  [5] (data from MRSA252)
    SACOL1091(ptsH)phosphocarrier protein HPr  [5] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [5] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [5] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [5] (data from MRSA252)
    SACOL2212(rplQ)50S ribosomal protein L17  [5] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [5] (data from MRSA252)
    SACOL1516(rpsA)30S ribosomal protein S1  [5] (data from MRSA252)
    SACOL0437(rpsF)30S ribosomal protein S6  [5] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [5] (data from MRSA252)
    SACOL1449(sucA)2-oxoglutarate dehydrogenase E1 component  [5] (data from MRSA252)
    SACOL1262(sucC)succinyl-CoA synthetase subunit beta  [5] (data from MRSA252)
    SACOL1155(trxA)thioredoxin  [5] (data from MRSA252)
    SACOL0426acetyl-CoA acetyltransferase  [5] (data from MRSA252)
    SACOL0564pyridoxal biosynthesis lyase PdxS  [5] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [5] (data from MRSA252)
    SACOL1020hypothetical protein  [5] (data from MRSA252)
    SACOL1670hypothetical protein  [5] (data from MRSA252)

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: 29.54 h [6]

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Dörte Becher, Kristina Hempel, Susanne Sievers, Daniela Zühlke, Jan Pané-Farré, Andreas Otto, Stephan Fuchs, Dirk Albrecht, Jörg Bernhardt, Susanne Engelmann, Uwe Völker, Jan Maarten van Dijl, Michael Hecker
    A proteomic view of an important human pathogen--towards the quantification of the entire Staphylococcus aureus proteome.
    PLoS One: 2009, 4(12);e8176
    [PubMed:19997597] [WorldCat.org] [DOI] (I e)
  2. Kristina Hempel, Florian-Alexander Herbst, Martin Moche, Michael Hecker, Dörte Becher
    Quantitative proteomic view on secreted, cell surface-associated, and cytoplasmic proteins of the methicillin-resistant human pathogen Staphylococcus aureus under iron-limited conditions.
    J Proteome Res: 2011, 10(4);1657-66
    [PubMed:21323324] [WorldCat.org] [DOI] (I p)
  3. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  4. Daniela Zühlke, Kirsten Dörries, Jörg Bernhardt, Sandra Maaß, Jan Muntel, Volkmar Liebscher, Jan Pané-Farré, Katharina Riedel, Michael Lalk, Uwe Völker, Susanne Engelmann, Dörte Becher, Stephan Fuchs, Michael Hecker
    Costs of life - Dynamics of the protein inventory of Staphylococcus aureus during anaerobiosis.
    Sci Rep: 2016, 6;28172
    [PubMed:27344979] [WorldCat.org] [DOI] (I e)
  5. 5.00 5.01 5.02 5.03 5.04 5.05 5.06 5.07 5.08 5.09 5.10 5.11 5.12 5.13 5.14 5.15 5.16 5.17 5.18 5.19 5.20 5.21 5.22 5.23 5.24 5.25 5.26 5.27 5.28 5.29 5.30 5.31 5.32 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)
  6. Stephan Michalik, Jörg Bernhardt, Andreas Otto, Martin Moche, Dörte Becher, Hanna Meyer, Michael Lalk, Claudia Schurmann, Rabea Schlüter, Holger Kock, Ulf Gerth, Michael Hecker
    Life and death of proteins: a case study of glucose-starved Staphylococcus aureus.
    Mol Cell Proteomics: 2012, 11(9);558-70
    [PubMed:22556279] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]

Kamel El Omari, Balvinder Dhaliwal, Michael Lockyer, Ian Charles, Alastair R Hawkins, David K Stammers
Structure of Staphylococcus aureus guanylate monophosphate kinase.
Acta Crystallogr Sect F Struct Biol Cryst Commun: 2006, 62(Pt 10);949-53
[PubMed:17012781] [WorldCat.org] [DOI] (I p)