From AureoWiki
Jump to navigation Jump to search
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
m (Text replacement - "gene Genbank" to "gene RefSeq")
 
Line 1: Line 1:
__TOC__
<protect>
<protect>
<aureodatabase>NCBI date</aureodatabase>
<aureodatabase>annotation</aureodatabase>


=Summary=
=Summary=


* <aureodatabase>organism</aureodatabase>
*<aureodatabase>organism</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>pan locus</aureodatabase>
*<aureodatabase>pan locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>pan gene symbol</aureodatabase>
*<aureodatabase>pan gene symbol</aureodatabase>
* <aureodatabase>gene synonyms</aureodatabase>
*<aureodatabase>gene synonyms</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
</protect>
</protect>


Line 24: Line 25:
==General==
==General==


* <aureodatabase>gene type</aureodatabase>
*<aureodatabase>gene type</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
* <aureodatabase>gene replicon</aureodatabase>
*<aureodatabase>gene replicon</aureodatabase>
* <aureodatabase>strand</aureodatabase>
*<aureodatabase>strand</aureodatabase>
* <aureodatabase>gene coordinates</aureodatabase>
*<aureodatabase>gene coordinates</aureodatabase>
* <aureodatabase>gene length</aureodatabase>
*<aureodatabase>gene length</aureodatabase>
* <aureodatabase>essential</aureodatabase>
*<aureodatabase>essential</aureodatabase>
*<aureodatabase>gene comment</aureodatabase>
</protect>
</protect>


Line 38: Line 40:
==Accession numbers==
==Accession numbers==


* <aureodatabase>gene GI</aureodatabase>
*<aureodatabase>gene GI</aureodatabase>
* <aureodatabase>gene Genbank</aureodatabase>
*<aureodatabase>gene RefSeq</aureodatabase>
*<aureodatabase>gene BioCyc</aureodatabase>
*<aureodatabase>gene MicrobesOnline</aureodatabase>
</protect>
</protect>
   
   
<protect>  
<protect>
==Phenotype==
==Phenotype==
</protect>
</protect>
* Share your knowledge and add information here. [<span class="plainlinks">[http://www.protecs.uni-greifswald.de/aureowiki/index.php?title={{PAGENAMEE}}&action=edit&section=6 edit]</span>]
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit&section=6 edit]</span>]


<protect>
<protect>
==DNA sequence==
==DNA sequence==


* <aureodatabase>gene sequence</aureodatabase>
*<aureodatabase>gene sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
<aureodatabase>RNA regulated operons</aureodatabase>
</protect>


<protect>
=Protein=
=Protein=
<aureodatabase>protein 3D view</aureodatabase>
<aureodatabase>protein 3D view</aureodatabase>
==General==
==General==


* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>protein symbol</aureodatabase>
*<aureodatabase>protein symbol</aureodatabase>
* <aureodatabase>protein description</aureodatabase>
*<aureodatabase>protein description</aureodatabase>
* <aureodatabase>protein length</aureodatabase>
*<aureodatabase>protein length</aureodatabase>
* <aureodatabase>theoretical pI</aureodatabase>
*<aureodatabase>theoretical pI</aureodatabase>
* <aureodatabase>theoretical MW</aureodatabase>
*<aureodatabase>theoretical MW</aureodatabase>
* <aureodatabase>GRAVY</aureodatabase>
*<aureodatabase>GRAVY</aureodatabase>
</protect>
</protect>


Line 71: Line 78:
==Function==
==Function==


* <aureodatabase>protein reaction</aureodatabase>
*<aureodatabase>protein reaction</aureodatabase>
* <aureodatabase>protein TIGRFAM</aureodatabase>
*<aureodatabase>protein TIGRFAM</aureodatabase>
* <aureodatabase>protein TheSeed</aureodatabase>
*<aureodatabase>protein TheSeed</aureodatabase>
* <aureodatabase>protein PFAM</aureodatabase>
*<aureodatabase>protein PFAM</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Structure, modifications & interactions==
==Structure, modifications & cofactors==


* <aureodatabase>protein domains</aureodatabase>
*<aureodatabase>protein domains</aureodatabase>
* <aureodatabase>protein modifications</aureodatabase>
*<aureodatabase>protein modifications</aureodatabase>
* <aureodatabase>protein cofactors</aureodatabase>
*<aureodatabase>protein cofactors</aureodatabase>
* <aureodatabase>protein effectors</aureodatabase>
*<aureodatabase>protein effectors</aureodatabase>
* <aureodatabase>protein partners</aureodatabase>
*<aureodatabase>protein regulated operons</aureodatabase>
</protect>
</protect>


Line 90: Line 97:
==Localization==
==Localization==


* <aureodatabase>protein Psortb</aureodatabase>
*<aureodatabase>protein Psortb</aureodatabase>
* <aureodatabase>protein LocateP</aureodatabase>
*<aureodatabase>protein LocateP</aureodatabase>
* <aureodatabase>protein SignalP</aureodatabase>
*<aureodatabase>protein SignalP</aureodatabase>
* <aureodatabase>protein TMHMM</aureodatabase>
*<aureodatabase>protein TMHMM</aureodatabase>
</protect>
</protect>


Line 99: Line 106:
==Accession numbers==
==Accession numbers==


* <aureodatabase>protein GI</aureodatabase>
*<aureodatabase>protein GI</aureodatabase>
* <aureodatabase>protein UniProt</aureodatabase>
*<aureodatabase>protein RefSeq</aureodatabase>
* <aureodatabase>protein RefSeq</aureodatabase>
*<aureodatabase>protein UniProt</aureodatabase>
</protect>
</protect>


Line 107: Line 114:
==Protein sequence==
==Protein sequence==


* <aureodatabase>protein sequence</aureodatabase>
*<aureodatabase>protein sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Peptides==
==Experimental data==


* <aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated localization</aureodatabase>
*<aureodatabase>protein validated quantitative data</aureodatabase>
*<aureodatabase>protein partners</aureodatabase>
</protect>
</protect>


Line 124: Line 134:
==Operon==
==Operon==


* <aureodatabase>operons</aureodatabase>
*<aureodatabase>operons</aureodatabase>
</protect>
</protect>


Line 130: Line 140:
==Regulation==
==Regulation==


* <aureodatabase>sigma factors</aureodatabase>
*<aureodatabase>regulators</aureodatabase>
* <aureodatabase>regulators</aureodatabase>
</protect>
</protect>


Line 137: Line 146:
==Transcription pattern==
==Transcription pattern==


* <aureodatabase>expression browser</aureodatabase>
*<aureodatabase>expression browser</aureodatabase>
</protect>
</protect>


Line 143: Line 152:
==Protein synthesis (provided by Aureolib)==
==Protein synthesis (provided by Aureolib)==


* <aureodatabase>protein synthesis Aureolib</aureodatabase>
*<aureodatabase>protein synthesis Aureolib</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Stability==
==Protein stability==


* <aureodatabase>protein half-life</aureodatabase>
*<aureodatabase>protein half-life</aureodatabase>
</protect>
</protect>



Latest revision as of 11:23, 11 March 2016

NCBI: 10-JUN-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL0873 [new locus tag: SACOL_RS04480 ]
  • pan locus tag?: SAUPAN002817000
  • symbol: aroD
  • pan gene symbol?: aroD
  • synonym:
  • product: 3-dehydroquinate dehydratase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL0873 [new locus tag: SACOL_RS04480 ]
  • symbol: aroD
  • product: 3-dehydroquinate dehydratase
  • replicon: chromosome
  • strand: +
  • coordinates: 895226..895942
  • length: 717
  • essential: unknown other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    ATGACACATGTGGAAGTAGTAGCGACTATCGCGCCACAATTATCTATCGAAGAAACTTTA
    ATTCAAAAAATTAATCATCGTATTGATGCAATAGACGTATTAGAATTACGAATTGATCAA
    ATTGAAAATGTCACAGTTGATCAAGTGGCAGAAATGATTACAAAGCTGAAGGTTATGCAA
    GATTCATTCAAATTATTAGTTACGTATCGTACAAAGTTACAAGGTGGCTATGGGCAATTT
    ACAAATGACTCGTATCTTAATTTAATATCAGACTTAGCAAATATCAATGGCATAGATATG
    ATTGATATAGAATGGCAAGCAGATATTGACATTGAAAAACATCAACGAATCATTACACAT
    TTGCAACAGTATAATAAAGAGGTGGTTATATCACATCATAATTTCGAAAGTACGCCTCCA
    TTAGATGAATTGCAATTTATATTTTTTAAAATGCAAAAATTCAACCCAGAATACGTTAAA
    TTAGCAGTAATGCCACATAATAAAAATGATGTGTTAAATTTATTGCAGGCAATGTCTACA
    TTTTCAGATACTATGGACTGCAAAGTTGTTGGTATTTCAATGTCTAAACTTGGACTAATA
    AGTAGAACGGCTCAAGGCGTTTTTGGTGGTGCGTTGACTTATGGTTGTATCGGAGTACCA
    CAAGCTCCAGGACAGATTGATGTTACTGATTTAAAAGCACAAGTGACTTTATACTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    717

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL0873 [new locus tag: SACOL_RS04480 ]
  • symbol: AroD
  • description: 3-dehydroquinate dehydratase
  • length: 238
  • theoretical pI: 4.90902
  • theoretical MW: 26868.8
  • GRAVY: -0.0155462

Function[edit | edit source]

  • reaction:
    EC 4.2.1.10?  ExPASy
    3-dehydroquinate dehydratase 3-dehydroquinate = 3-dehydroshikimate + H2O
  • TIGRFAM:
    Metabolism Amino acid biosynthesis Aromatic amino acid family 3-dehydroquinate dehydratase, type I (TIGR01093; EC 4.2.1.10; HMM-score: 173.2)
  • TheSEED  :
    • 3-dehydroquinate dehydratase I (EC 4.2.1.10)
    Amino Acids and Derivatives Aromatic amino acids and derivatives Chorismate Synthesis  3-dehydroquinate dehydratase I (EC 4.2.1.10)
    and 2 more
    Amino Acids and Derivatives Aromatic amino acids and derivatives Common Pathway For Synthesis of Aromatic Compounds (DAHP synthase to chorismate)  3-dehydroquinate dehydratase I (EC 4.2.1.10)
    Metabolism of Aromatic Compounds Peripheral pathways for catabolism of aromatic compounds Quinate degradation  3-dehydroquinate dehydratase I (EC 4.2.1.10)
  • PFAM:
    TIM_barrel (CL0036) DHquinase_I; Type I 3-dehydroquinase (PF01487; HMM-score: 165)
    and 1 more
    no clan defined Borrelia_lipo_2; Borrelia burgdorferi BBR25 lipoprotein (PF06238; HMM-score: 10.4)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.001965
    • TAT(Tat/SPI): 0.000074
    • LIPO(Sec/SPII): 0.00016
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTHVEVVATIAPQLSIEETLIQKINHRIDAIDVLELRIDQIENVTVDQVAEMITKLKVMQDSFKLLVTYRTKLQGGYGQFTNDSYLNLISDLANINGIDMIDIEWQADIDIEKHQRIITHLQQYNKEVVISHHNFESTPPLDELQFIFFKMQKFNPEYVKLAVMPHNKNDVLNLLQAMSTFSDTMDCKVVGISMSKLGLISRTAQGVFGGALTYGCIGVPQAPGQIDVTDLKAQVTLY

Experimental data[edit | edit source]

  • experimentally validated: PeptideAtlas
  • protein localization: Cytoplasmic [1]
  • quantitative data / protein copy number per cell:
  • interaction partners:
    SACOL1760(ackA)acetate kinase  [2] (data from MRSA252)
    SACOL1385(acnA)aconitate hydratase  [2] (data from MRSA252)
    SACOL0660(adhP)alcohol dehydrogenase  [2] (data from MRSA252)
    SACOL0452(ahpC)alkyl hydroperoxide reductase subunit C  [2] (data from MRSA252)
    SACOL2657(arcA)arginine deiminase  [2] (data from MRSA252)
    SACOL2656(arcB2)ornithine carbamoyltransferase  [2] (data from MRSA252)
    SACOL2654(arcC2)carbamate kinase  [2] (data from MRSA252)
    SACOL1494(asnC)asparaginyl-tRNA synthetase  [2] (data from MRSA252)
    SACOL0557(cysK)cysteine synthase  [2] (data from MRSA252)
    SACOL1800(dat)D-alanine aminotransferase  [2] (data from MRSA252)
    SACOL1637(dnaK)molecular chaperone DnaK  [2] (data from MRSA252)
    SACOL0842(eno)phosphopyruvate hydratase  [2] (data from MRSA252)
    SACOL0634(eutD)phosphotransacetylase  [2] (data from MRSA252)
    SACOL0988(fabF)3-oxoacyl-ACP synthase  [2] (data from MRSA252)
    SACOL2622(fdaB)fructose-1,6-bisphosphate aldolase  [2] (data from MRSA252)
    SACOL1199(ftsZ)cell division protein FtsZ  [2] (data from MRSA252)
    SACOL0593(fusA)elongation factor G  [2] (data from MRSA252)
    SACOL0838(gapA1)glyceraldehyde 3-phosphate dehydrogenase  [2] (data from MRSA252)
    SACOL1734(gapA2)glyceraldehyde 3-phosphate dehydrogenase 2  [2] (data from MRSA252)
    SACOL1961(gatA)aspartyl/glutamyl-tRNA amidotransferase subunit A  [2] (data from MRSA252)
    SACOL2145(glmS)glucosamine--fructose-6-phosphate aminotransferase  [2] (data from MRSA252)
    SACOL0961(gluD)glutamate dehydrogenase  [2] (data from MRSA252)
    SACOL1622(glyS)glycyl-tRNA synthetase  [2] (data from MRSA252)
    SACOL1554(gnd)6-phosphogluconate dehydrogenase  [2] (data from MRSA252)
    SACOL2017(groES)co-chaperonin GroES  [2] (data from MRSA252)
    SACOL0461(guaA)GMP synthase  [2] (data from MRSA252)
    SACOL1513(hup)DNA-binding protein HU  [2] (data from MRSA252)
    SACOL1741(icd)isocitrate dehydrogenase  [2] (data from MRSA252)
    SACOL1477(ilvA1)threonine dehydratase  [2] (data from MRSA252)
    SACOL1288(infB)translation initiation factor IF-2  [2] (data from MRSA252)
    SACOL0222(ldh1)L-lactate dehydrogenase  [2] (data from MRSA252)
    SACOL2618(ldh2)L-lactate dehydrogenase  [2] (data from MRSA252)
    SACOL0562(lysS)lysyl-tRNA synthetase  [2] (data from MRSA252)
    SACOL2623(mqo2)malate:quinone oxidoreductase  [2] (data from MRSA252)
    SACOL2116(murAB)UDP-N-acetylglucosamine 1-carboxyvinyltransferase  [2] (data from MRSA252)
    SACOL0746(norR)MarR family transcriptional regulator  [2] (data from MRSA252)
    SACOL0792(nrdE)ribonucleotide-diphosphate reductase subunit alpha  [2] (data from MRSA252)
    SACOL1285(nusA)transcription elongation factor NusA  [2] (data from MRSA252)
    SACOL1102(pdhA)pyruvate dehydrogenase complex E1 component subunit alpha  [2] (data from MRSA252)
    SACOL1103(pdhB)pyruvate dehydrogenase complex E1 component subunit beta  [2] (data from MRSA252)
    SACOL1104(pdhC)branched-chain alpha-keto acid dehydrogenase E2  [2] (data from MRSA252)
    SACOL1105(pdhD)dihydrolipoamide dehydrogenase  [2] (data from MRSA252)
    SACOL1005(pepF)oligoendopeptidase F  [2] (data from MRSA252)
    SACOL0204(pflB)formate acetyltransferase  [2] (data from MRSA252)
    SACOL0966(pgi)glucose-6-phosphate isomerase  [2] (data from MRSA252)
    SACOL0839(pgk)phosphoglycerate kinase  [2] (data from MRSA252)
    SACOL1982(ppaC)manganese-dependent inorganic pyrophosphatase  [2] (data from MRSA252)
    SACOL1745(pyk)pyruvate kinase  [2] (data from MRSA252)
    SACOL0584(rplA)50S ribosomal protein L1  [2] (data from MRSA252)
    SACOL2236(rplB)50S ribosomal protein L2  [2] (data from MRSA252)
    SACOL2239(rplC)50S ribosomal protein L3  [2] (data from MRSA252)
    SACOL2238(rplD)50S ribosomal protein L4  [2] (data from MRSA252)
    SACOL2227(rplE)50S ribosomal protein L5  [2] (data from MRSA252)
    SACOL2224(rplF)50S ribosomal protein L6  [2] (data from MRSA252)
    SACOL0015(rplI)50S ribosomal protein L9  [2] (data from MRSA252)
    SACOL0585(rplJ)50S ribosomal protein L10  [2] (data from MRSA252)
    SACOL0583(rplK)50S ribosomal protein L11  [2] (data from MRSA252)
    SACOL0586(rplL)50S ribosomal protein L7/L12  [2] (data from MRSA252)
    SACOL2207(rplM)50S ribosomal protein L13  [2] (data from MRSA252)
    SACOL2220(rplO)50S ribosomal protein L15  [2] (data from MRSA252)
    SACOL2212(rplQ)50S ribosomal protein L17  [2] (data from MRSA252)
    SACOL2223(rplR)50S ribosomal protein L18  [2] (data from MRSA252)
    SACOL1257(rplS)50S ribosomal protein L19  [2] (data from MRSA252)
    SACOL1725(rplT)50S ribosomal protein L20  [2] (data from MRSA252)
    SACOL1702(rplU)50S ribosomal protein L21  [2] (data from MRSA252)
    SACOL2234(rplV)50S ribosomal protein L22  [2] (data from MRSA252)
    SACOL2237(rplW)50S ribosomal protein L23  [2] (data from MRSA252)
    SACOL0545(rplY)50S ribosomal protein L25/general stress protein Ctc  [2] (data from MRSA252)
    SACOL2213(rpoA)DNA-directed RNA polymerase subunit alpha  [2] (data from MRSA252)
    SACOL0589(rpoC)DNA-directed RNA polymerase subunit beta'  [2] (data from MRSA252)
    SACOL1516(rpsA)30S ribosomal protein S1  [2] (data from MRSA252)
    SACOL1274(rpsB)30S ribosomal protein S2  [2] (data from MRSA252)
    SACOL2233(rpsC)30S ribosomal protein S3  [2] (data from MRSA252)
    SACOL1769(rpsD)30S ribosomal protein S4  [2] (data from MRSA252)
    SACOL2222(rpsE)30S ribosomal protein S5  [2] (data from MRSA252)
    SACOL2206(rpsI)30S ribosomal protein S9  [2] (data from MRSA252)
    SACOL2214(rpsK)30S ribosomal protein S11  [2] (data from MRSA252)
    SACOL1254(rpsP)30S ribosomal protein S16  [2] (data from MRSA252)
    SACOL2235(rpsS)30S ribosomal protein S19  [2] (data from MRSA252)
    SACOL0095(spa)immunoglobulin G binding protein A precursor  [2] (data from MRSA252)
    SACOL1449(sucA)2-oxoglutarate dehydrogenase E1 component  [2] (data from MRSA252)
    SACOL1448(sucB)dihydrolipoamide succinyltransferase  [2] (data from MRSA252)
    SACOL1831(tal)translaldolase  [2] (data from MRSA252)
    SACOL0626(thiD1)phosphomethylpyrimidine kinase  [2] (data from MRSA252)
    SACOL1729(thrS)threonyl-tRNA synthetase  [2] (data from MRSA252)
    SACOL1722(tig)trigger factor  [2] (data from MRSA252)
    SACOL0840(tpiA)triosephosphate isomerase  [2] (data from MRSA252)
    SACOL1762(tpx)thiol peroxidase  [2] (data from MRSA252)
    SACOL1155(trxA)thioredoxin  [2] (data from MRSA252)
    SACOL1276(tsf)elongation factor Ts  [2] (data from MRSA252)
    SACOL0594(tuf)elongation factor Tu  [2] (data from MRSA252)
    SACOL1118(typA)GTP-binding protein TypA  [2] (data from MRSA252)
    SACOL2104(upp)uracil phosphoribosyltransferase  [2] (data from MRSA252)
    SACOL0521hypothetical protein  [2] (data from MRSA252)
    SACOL0564pyridoxal biosynthesis lyase PdxS  [2] (data from MRSA252)
    SACOL0721hypothetical protein  [2] (data from MRSA252)
    SACOL0731LysR family transcriptional regulator  [2] (data from MRSA252)
    SACOL0815ribosomal subunit interface protein  [2] (data from MRSA252)
    SACOL0876hypothetical protein  [2] (data from MRSA252)
    SACOL0944NADH dehydrogenase  [2] (data from MRSA252)
    SACOL0973fumarylacetoacetate hydrolase  [2] (data from MRSA252)
    SACOL1801dipeptidase PepV  [2] (data from MRSA252)
    SACOL1952ferritins family protein  [2] (data from MRSA252)
    SACOL2114aldehyde dehydrogenase  [2] (data from MRSA252)
    SACOL2173alkaline shock protein 23  [2] (data from MRSA252)
    SACOL2296glycerate dehydrogenase  [2] (data from MRSA252)
    SACOL25691-pyrroline-5-carboxylate dehydrogenase  [2] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. Andreas Otto, Jan Maarten van Dijl, Michael Hecker, Dörte Becher
    The Staphylococcus aureus proteome.
    Int J Med Microbiol: 2014, 304(2);110-20
    [PubMed:24439828] [WorldCat.org] [DOI] (I p)
  2. 2.000 2.001 2.002 2.003 2.004 2.005 2.006 2.007 2.008 2.009 2.010 2.011 2.012 2.013 2.014 2.015 2.016 2.017 2.018 2.019 2.020 2.021 2.022 2.023 2.024 2.025 2.026 2.027 2.028 2.029 2.030 2.031 2.032 2.033 2.034 2.035 2.036 2.037 2.038 2.039 2.040 2.041 2.042 2.043 2.044 2.045 2.046 2.047 2.048 2.049 2.050 2.051 2.052 2.053 2.054 2.055 2.056 2.057 2.058 2.059 2.060 2.061 2.062 2.063 2.064 2.065 2.066 2.067 2.068 2.069 2.070 2.071 2.072 2.073 2.074 2.075 2.076 2.077 2.078 2.079 2.080 2.081 2.082 2.083 2.084 2.085 2.086 2.087 2.088 2.089 2.090 2.091 2.092 2.093 2.094 2.095 2.096 2.097 2.098 2.099 2.100 2.101 2.102 2.103 2.104 2.105 2.106 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]