From AureoWiki
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS06155 [old locus tag: SA1086 ]
  • pan locus tag?: SAUPAN003535000
  • symbol: SA_RS06155
  • pan gene symbol?: rbgA
  • synonym:
  • product: ribosome biogenesis GTPase YlqF

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS06155 [old locus tag: SA1086 ]
  • symbol: SA_RS06155
  • product: ribosome biogenesis GTPase YlqF
  • replicon: chromosome
  • strand: +
  • coordinates: 1229515..1230399
  • length: 885
  • essential: yes [1] DEG other strains

Accession numbers[edit | edit source]

  • Location: NC_002745 (1229515..1230399) NCBI
  • BioCyc: SA_RS06155 BioCyc
  • MicrobesOnline: see SA1086

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGGTTATTCAATGGTATCCAGGACATATGGCGAAAGCCAAAAGAGAAGTAAGTGAACAA
    TTAAAAAAAGTAGATGTAGTGTTTGAACTAGTAGATGCAAGAATTCCATATAGTTCAAGA
    AACCCTATGATAGATGAAGTTATTAACCAAAAACCACGTGTTGTTATATTAAATAAAAAA
    GATATGTCTAATTTAAATGAGATGTCAAAATGGGAACAATTTTTTATTGATAAAGGATAC
    TATCCTGTATCAGTGGATGCTAAGCACGGTAAAAATTTAAAGAAAGTGGAAGCTGCAGCA
    ATTAAGGCGACTGCTGAAAAATTTGAACGCGAAAAAGCGAAAGGACTTAAACCTAGAGCG
    ATAAGAGCAATGATCGTTGGAATTCCAAATGTTGGTAAATCCACATTAATAAATAAACTG
    GCAAAGCGTAGTATTGCGCAGACTGGTAATAAACCAGGTGTGACCAAACAACAACAATGG
    ATTAAAGTTAGTAATGCATTACAACTATTAGACACACCAGGGATACTTTGGCCTAAATTT
    GAAGATGAAGAAGTCGGTAAGAAGTTGAGTTTAACTGGTGCGATAAAAGATAGTATTGTG
    CACTTAGATGAAGTTGCCATCTATGGATTAAACTTTTTAATTCAAAATGATTTAGCGCGA
    TTAAAGTCACATTATAATATTGAAGTTCCTGAAGATGCAGAAATCATAGCGTGGTTTGAT
    GCGATAGGGAAAAAACGTGGCTTAATTCGACGTGGTAATGAAATTGATTACGAAGCAGTC
    ATTGAACTGATTATTTATGATATTCGAAATGCTAAAATAGGAAATTATTGTTTTGATATT
    TTTAAAGATATGACTGAGGAATTAGCAAATGACGCTAACAATTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    885

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS06155 [old locus tag: SA1086 ]
  • symbol: SA_RS06155
  • description: ribosome biogenesis GTPase YlqF
  • length: 294
  • theoretical pI: 9.6036
  • theoretical MW: 33410.5
  • GRAVY: -0.351701

Function[edit | edit source]

  • TIGRFAM:
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YlqF (TIGR03596; HMM-score: 365.3)
    and 16 more
    Genetic information processing Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 72.1)
    Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 54.6)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 53.7)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 49.9)
    Genetic information processing Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 44.4)
    Genetic information processing Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 38.3)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 34.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds ferrous iron transport protein B (TIGR00437; HMM-score: 28.5)
    Genetic information processing Protein synthesis Other Obg family GTPase CgtA (TIGR02729; HMM-score: 25.3)
    Unknown function General GTP-binding protein HflX (TIGR03156; HMM-score: 23.8)
    Unknown function General GTP-binding protein YchF (TIGR00092; HMM-score: 23.6)
    Genetic information processing Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 22)
    Metabolism Transport and binding proteins Amino acids, peptides and amines LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.7)
    Signal transduction Regulatory functions Protein interactions LAO/AO transport system ATPase (TIGR00750; EC 2.7.-.-; HMM-score: 14.7)
    Metabolism Energy metabolism Amino acids and amines ethanolamine utilization protein, EutP (TIGR02528; HMM-score: 13.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking signal recognition particle-docking protein FtsY (TIGR00064; HMM-score: 13.1)
  • TheSEED: see SA1086
  • PFAM:
    P-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 72.9)
    and 14 more
    FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 41.3)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 33.2)
    AAA_18; AAA domain (PF13238; HMM-score: 21.5)
    Arf; ADP-ribosylation factor family (PF00025; HMM-score: 18.3)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 18.2)
    Roc; Ras of Complex, Roc, domain of DAPkinase (PF08477; HMM-score: 15)
    ArgK; ArgK protein (PF03308; HMM-score: 14.8)
    Septin; Septin (PF00735; HMM-score: 13.9)
    Ras; Ras family (PF00071; HMM-score: 13.8)
    AAA_14; AAA domain (PF13173; HMM-score: 13.3)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 12.8)
    PduV-EutP; Ethanolamine utilisation - propanediol utilisation (PF10662; HMM-score: 12.7)
    SRPRB; Signal recognition particle receptor beta subunit (PF09439; HMM-score: 12.6)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 12.3)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.002066
    • TAT(Tat/SPI): 0.00021
    • LIPO(Sec/SPII): 0.000572
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MVIQWYPGHMAKAKREVSEQLKKVDVVFELVDARIPYSSRNPMIDEVINQKPRVVILNKKDMSNLNEMSKWEQFFIDKGYYPVSVDAKHGKNLKKVEAAAIKATAEKFEREKAKGLKPRAIRAMIVGIPNVGKSTLINKLAKRSIAQTGNKPGVTKQQQWIKVSNALQLLDTPGILWPKFEDEEVGKKLSLTGAIKDSIVHLDEVAIYGLNFLIQNDLARLKSHYNIEVPEDAEIIAWFDAIGKKRGLIRRGNEIDYEAVIELIIYDIRNAKIGNYCFDIFKDMTEELANDANN

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SA_RS11130(deoA)pyrimidine-nucleoside phosphorylase  [2] (data from MRSA252)
    SA_RS00690immunoglobulin G-binding protein A  [2] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [2] (data from MRSA252)
    SA_RS017105'-nucleotidase, lipoprotein e(P4) family  [2] (data from MRSA252)
    SA_RS0291050S ribosomal protein L1  [2] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [2] (data from MRSA252)
    SA_RS0292050S ribosomal protein L7/L12  [2] (data from MRSA252)
    SA_RS0294530S ribosomal protein S12  [2] (data from MRSA252)
    SA_RS02955elongation factor G  [2] (data from MRSA252)
    SA_RS02960elongation factor Tu  [2] (data from MRSA252)
    SA_RS04025preprotein translocase subunit SecA  [2] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [2] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [2] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [2] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [2] (data from MRSA252)
    SA_RS05365dihydrolipoyl dehydrogenase  [2] (data from MRSA252)
    SA_RS05860cell division protein FtsZ  [2] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [2] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [2] (data from MRSA252)
    SA_RS07060dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [2] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [2] (data from MRSA252)
    SA_RS07955molecular chaperone DnaK  [2] (data from MRSA252)
    SA_RS0829550S ribosomal protein L21  [2] (data from MRSA252)
    SA_RS0846050S ribosomal protein L20  [2] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [2] (data from MRSA252)
    SA_RS08560pyruvate kinase  [2] (data from MRSA252)
    SA_RS08565ATP-dependent 6-phosphofructokinase  [2] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [2] (data from MRSA252)
    SA_RS11430Asp23/Gls24 family envelope stress response protein  [2] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [2] (data from MRSA252)
    SA_RS1164030S ribosomal protein S11  [2] (data from MRSA252)
    SA_RS1167050S ribosomal protein L15  [2] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [2] (data from MRSA252)
    SA_RS1168550S ribosomal protein L18  [2] (data from MRSA252)
    SA_RS1169050S ribosomal protein L6  [2] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [2] (data from MRSA252)
    SA_RS1172030S ribosomal protein S17  [2] (data from MRSA252)
    SA_RS1173050S ribosomal protein L16  [2] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [2] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [2] (data from MRSA252)
    SA_RS1175050S ribosomal protein L2  [2] (data from MRSA252)
    SA_RS1175550S ribosomal protein L23  [2] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [2] (data from MRSA252)
    SA_RS1176550S ribosomal protein L3  [2] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [2] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol Microbiol: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] [DOI] (P p)
  2. 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 2.35 2.36 2.37 2.38 2.39 2.40 2.41 2.42 2.43 2.44 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]