From AureoWiki
Jump to navigation Jump to search
PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159JSNZLGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SACOL_RS01820 [old locus tag: SACOL0362 ]
  • symbol: SACOL_RS01820
  • product: hypothetical protein
  • replicon: chromosome
  • strand: +
  • coordinates: 372375..372575
  • length: 201
  • essential: unknown other strains

Accession numbers[edit | edit source]

  • Location: NC_002951 (372375..372575) NCBI
  • BioCyc: SACOL_RS01820 BioCyc
  • MicrobesOnline: see SACOL0362

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    ATGTGGATTGTCATTTCAATTGTTTTATCTATATTTTTATTGATCTTGTTAAGTAGCATT
    TCTCATAAGATGAAAACCATAGAAGCATTGGAGTATATGAATGCTTATCTTTTCAAGCAG
    TTAGTAAAAAATAATGGTGTTGAAGGTTTAGAAGATTATGAAAATGAAGTTGAACGAATT
    AGAAAAAGATTCAAAAGCTAA
    60
    120
    180
    201

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS01820 [old locus tag: SACOL0362 ]
  • symbol: SACOL_RS01820
  • description: hypothetical protein
  • length: 66
  • theoretical pI: 8.97623
  • theoretical MW: 7806.21
  • GRAVY: 0.184848

Function[edit | edit source]

  • TIGRFAM:
    type II secretion system protein I (TIGR01707; HMM-score: 12.6)
  • TheSEED: see SACOL0362
  • PFAM:
    no clan defined DUF1514; Protein of unknown function (DUF1514) (PF07438; HMM-score: 133.5)
    and 1 more
    Comm; Commissureless (PF15957; HMM-score: 8.9)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.32
    • Cytoplasmic Membrane Score: 9.55
    • Cellwall Score: 0.12
    • Extracellular Score: 0.01
    • Internal Helix: 1
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.0013
    • Cytoplasmic Membrane Score: 0.7182
    • Cell wall & surface Score: 0.0015
    • Extracellular Score: 0.279
  • LocateP:
  • SignalP: Signal peptide SP(Sec/SPI) length 29 aa
    • SP(Sec/SPI): 0.529099
    • TAT(Tat/SPI): 0.00246
    • LIPO(Sec/SPII): 0.191734
    • Cleavage Site: CS pos: 29-30. IEA-LE. Pr: 0.4704
  • predicted transmembrane helices (TMHMM): 1

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MWIVISIVLSIFLLILLSSISHKMKTIEALEYMNAYLFKQLVKNNGVEGLEDYENEVERIRKRFKS

Experimental data[edit | edit source]

  • experimentally validated: data available for NCTC8325
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]