Navigation

  • Main page
  • Downloads
  • Getting Started
  • Recent changes
  • Random page
  • What links here
  • Related changes
  • Special pages
  • Printable version
  • Permanent link
  • Page information

personal-loginout

  • Log in
  • Not logged in
  • Talk
  • Contributions
  • Create account

Search

?

Navigation menu

Namespaces
  • Page
  • Discussion
English
UndoCtrl+ZRedoCtrl+Shift+Z, Ctrl+Y
Style text
LinkCtrl+K

Links

Link important words to other wiki articles or even other websites. It will help readers understand the context.

Okay, got it
Cite
Structure
Insert
Special character
Edit notices
Page options
Switch editor
Save changes…Alt+S
Views
  • Read
  • Edit
  • History
  • Edit source
ParagraphCtrl+0HeadingCtrl+2Sub-heading 1Ctrl+3Sub-heading 2Ctrl+4Sub-heading 3Ctrl+5Sub-heading 4Ctrl+6Header cellContent cellPreformattedCtrl+7Block quoteCtrl+8Page titleCtrl+1
BoldCtrl+BItalicCtrl+ISuperscriptCtrl+.SubscriptCtrl+,Computer codeCtrl+Shift+6StrikethroughCtrl+Shift+5UnderlineCtrl+UBigSmallLanguageRemoveCtrl+\, Ctrl+MMore
PubMedBasicCtrl+Shift+KRe-useMore
Bullet listNumbered listDecrease indentationShift+Tab, Ctrl+[Increase indentationTab, Ctrl+]More
Images and mediaTemplateTableCommentGalleryYour signatureReferences listMore
Read the user guideKeyboard shortcutsCtrl+/, Ctrl+Shift+/Toolbar searchCtrl+Shift+P, Ctrl+Alt+Shift+P
More
2 noticesClose
Warning: You are not logged in. Your IP address will be publicly visible if you make any edits. If you log in or create an account, your edits will be attributed to your username, along with other benefits.

You are using a browser which is not officially supported by this editor.

OptionsCategoriesPage settingsAdvanced settingsLanguagesTemplates used⧼visualeditor-changedir-rtl⧽Ctrl+Shift+XFind and replaceCtrl+FMore
Visual editingSource editingMore
From AureoWiki
Jump to navigation Jump to search
COLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159JSNZLGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40


⊟Summary[edit | edit source]

Contents

  • 1 Summary
  • 2 Genome View
  • 3 Gene
    • 3.1 General
    • 3.2 Accession numbers
    • 3.3 Phenotype
    • 3.4 DNA sequence
  • 4 Expression & Regulation
    • 4.1 Operon
    • 4.2 Regulation
    • 4.3 Transcription pattern
  • 5 Biological Material
    • 5.1 Mutants
    • 5.2 Expression vector
    • 5.3 lacZ fusion
    • 5.4 GFP fusion
    • 5.5 two-hybrid system
    • 5.6 FLAG-tag construct
    • 5.7 Antibody
  • 6 Other Information
  • 7 Literature
    • 7.1 References
    • 7.2 Relevant publications
  • organism: Staphylococcus aureus NCTC8325
  • locus tag: S527 [1]
  • symbol: S527
  • synonym:
  • product: RNA feature, intergenic transcript

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: misc_RNA
  • locus tag: S527 [1]
  • symbol: S527
  • product: RNA feature, intergenic transcript
  • replicon: chromosome
  • strand: +
  • coordinates: 1217317..1217534
  • length: 218
  • essential: unknown

⊟Accession numbers[edit | edit source]

  • SRD: srn_2680 SRD

⊟Phenotype[edit | edit source]

  • Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    GATTGAAAGTGATATTCATCTCATAAAGCTAGAATAATATCTAACTTTATGGGATACACT
    ACAAATCGAGACTATAAGGTTTTTTATTTTATTTATTATTACATTATCAATAGTTTTATA
    ATCGAGCTTCAAAACTTTAGAAAATAGTAGAAATAGCATTCAATATAGTGCAAAAGTGCA
    AATTGATAACTTGACACTTATCTCCTATAAACCGTACA
    60
    120
    180
    218

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

  • predicted SigA promoter [1] : S526 > recA > S527

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

  • S.aureus Expression Data Browser:  [1] 
    Expression Data Browser
    ⊟⊟Multi-gene expression profiles



    Click on any data point to display a description of the corresponding condition!


⊞Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊞Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

  1. ↑ Jump up to: 1.0 1.1 1.2 1.3 Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)

⊟Relevant publications[edit | edit source]

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=S527&oldid=103260"
Insert paragraph


⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus NCTC8325
  • locus tag: S527 [1]
  • symbol: S527
  • synonym:
  • product: RNA feature, intergenic transcript

  1. ↑ Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)
Insert paragraph

⊟Genome View[edit | edit source]

Insert paragraph

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: misc_RNA
  • locus tag: S527 [1]
  • symbol: S527
  • product: RNA feature, intergenic transcript
  • replicon: chromosome
  • strand: +
  • coordinates: 1217317..1217534
  • length: 218
  • essential: unknown

  1. ↑ Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)
Insert paragraph

⊟Accession numbers[edit | edit source]

  • SRD: srn_2680 SRD

Insert paragraph

⊟Phenotype[edit | edit source]

Insert paragraph

  • Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    GATTGAAAGTGATATTCATCTCATAAAGCTAGAATAATATCTAACTTTATGGGATACACT
    ACAAATCGAGACTATAAGGTTTTTTATTTTATTTATTATTACATTATCAATAGTTTTATA
    ATCGAGCTTCAAAACTTTAGAAAATAGTAGAAATAGCATTCAATATAGTGCAAAAGTGCA
    AATTGATAACTTGACACTTATCTCCTATAAACCGTACA
    60
    120
    180
    218

Insert paragraph

Insert paragraph

⊟Expression & Regulation[edit | edit source]

Insert paragraph

⊟Operon[edit | edit source]

  • predicted SigA promoter [1] : S526 > recA > S527

  1. ↑ Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)
Insert paragraph

⊟Regulation[edit | edit source]

  • regulator:

Insert paragraph

⊟Transcription pattern[edit | edit source]

  • S.aureus Expression Data Browser:  [1] 
    Expression Data Browser
    ⊟Multi-gene expression profiles

  1. ↑ Ulrike Mäder, Pierre Nicolas, Maren Depke, Jan Pané-Farré, Michel Debarbouille, Magdalena M van der Kooi-Pol, Cyprien Guérin, Sandra Dérozier, Aurelia Hiron, Hanne Jarmer, Aurélie Leduc, Stephan Michalik, Ewoud Reilman, Marc Schaffer, Frank Schmidt, Philippe Bessières, Philippe Noirot, Michael Hecker, Tarek Msadek, Uwe Völker, Jan Maarten van Dijl
    Staphylococcus aureus Transcriptome Architecture: From Laboratory to Infection-Mimicking Conditions.
    PLoS Genet: 2016, 12(4);e1005962
    [PubMed:27035918] [WorldCat.org] [DOI] (I e)


⊞Biological Material[edit | edit source]

Insert paragraph

⊟Mutants[edit | edit source]

Insert paragraph

⊟Expression vector[edit | edit source]

Insert paragraph

⊟lacZ fusion[edit | edit source]

Insert paragraph

⊟GFP fusion[edit | edit source]

Insert paragraph

⊟two-hybrid system[edit | edit source]

Insert paragraph

⊟FLAG-tag construct[edit | edit source]

Insert paragraph

⊟Antibody[edit | edit source]

Insert paragraph

⊞Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

Insert paragraph

⊟Relevant publications[edit | edit source]

Insert paragraph
  • This page was last edited on 12 February 2019, at 18:08.
  • Privacy and Cookies
  • About AureoWiki
  • Imprint
We use Matomo for user statistics and cookies. Privacy and Cookies X
We use Matomo for user statistics and cookies. Privacy and Cookies X