From AureoWiki
Jump to navigation Jump to search

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA2020
  • symbol: cbiO
  • product: cobalt transporter ATP-binding subunit
  • replicon: chromosome
  • strand: -
  • coordinates: 2292522..2293382
  • length: 861
  • essential: yes DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGACTATACGGTTTGACAATGTAAGTTATACCTATCAAAAAGGGACACCATATCAGCAT
    CAAGCTATTCATGATGTTAATACAGAATTTGAACAAGGTAAATATTACGCCATCGTTGGA
    CAAACGGGTAGTGGTAAATCAACGTTGATACAAAATATTAATGCGCTGTTAAAGCCGACT
    ACTGGGACAGTTACAGTTGATGACATTACTATTACACATAAGACCAAAGATAAATATATT
    AGACCTGTAAGAAAAAGAATTGGAATGGTATTTCAATTTCCCGAATCTCAATTATTTGAG
    GACACAGTAGAGCGTGAAATGATATTTGGACCTAAAAACTTTAAAATGAATTTAGATGAA
    GCCAAAAACTATGCCCATCGTCTGTTGATGGATTTAGGCTTTTCAAGAGATGTAATGTCA
    CAATCACCATTTCAAATGTCAGGTGGACAAATGCGTAAAATAGCGATTGTATCGATATTG
    GCAATGAATCCTGATATTATCGTGGTTGATGAACCTACAGCAGGACTTGATCCACAAAGT
    AAACGACAAGTAATGAGATTACTAAAGTCACTACAAACAGATGAAAATAAGGCAATTATC
    CTAATTTCACATGATATGAATGAAGTCGCGCGTTATGCAGATGAAGTCATCGTTATGAAA
    GAAGGTAGTATAGTGTCGCAAACATCACCAAAAGAGCTCTTCAAAGATAAAAAAAAATTG
    GCGGATTGGCATATTGGTTTGCCAGAAATTGTTCAGTTACAATATGACTTTGAACAAAAA
    TATCAAACAAAATTAAAAGATATTGCCTTAACTGAAGAAGCATTTGTAAGCTTGTATAAG
    GAGTGGCAACATGAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    861

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA2020
  • symbol: CbiO
  • description: cobalt transporter ATP-binding subunit
  • length: 286
  • theoretical pI: 7.25591
  • theoretical MW: 32918.6
  • GRAVY: -0.461538

Function[edit | edit source]

  • reaction:
    EC 3.6.3.-?  ExPASy
  • TIGRFAM:
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 367.8)
    and 79 more
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 256.1)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 154.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 153.5)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 152.4)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 145)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 144.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 140.9)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 135.3)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 132.7)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 130)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 129.1)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 129.1)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 123.1)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 122.5)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 122.2)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 120.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 120.6)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 119.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 119.4)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 118.9)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 118)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 115.6)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 115.6)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 114.1)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 112.4)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 110.4)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 109.4)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 107.1)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 104.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 104.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 104.3)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 103.2)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 100.9)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 98.9)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 98.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 97.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 95.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 95.9)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 94.9)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 93.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 93.4)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 92.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 91.4)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 91.4)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 91.4)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 88.9)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 88.9)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 86.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 83.9)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 82.6)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 81.3)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 78.6)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 77)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 76.5)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 76.5)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 74.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 72.6)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 72.6)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 72.1)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 68.9)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 66.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 66.4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 56.3)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 56.3)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 51.3)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 46.7)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 42.6)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 38.8)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 35.4)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA repair protein RecN (TIGR00634; HMM-score: 20.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking putative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 18.7)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 17.9)
    Genetic information processing Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 16.1)
    Cellular processes Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 15.5)
    helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 13.3)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 13.1)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions dTMP kinase (TIGR00041; EC 2.7.4.9; HMM-score: 13)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 13)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 12.1)
  • TheSEED  :
    • ECF transporter, ATPase component of energizing module
    Cofactors, Vitamins, Prosthetic Groups, Pigments Folate and pterines Folate Biosynthesis  ATPase component of general energizing module of ECF transporters
    and 1 more
    Membrane Transport Membrane Transport - no subcategory ECF class transporters  ATPase component of general energizing module of ECF transporters
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 101.6)
    and 36 more
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 48.1)
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 36.2)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 28.7)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 27)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 24.9)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 22.6)
    AAA_22; AAA domain (PF13401; HMM-score: 21.8)
    DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 21.3)
    AAA_23; AAA domain (PF13476; HMM-score: 19)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 18)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 17.9)
    SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 16.7)
    nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 16.7)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 16)
    ABC_ATPase; P-loop domain (PF09818; HMM-score: 16)
    AAA_19; AAA domain (PF13245; HMM-score: 15.9)
    AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 15.8)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 15.6)
    DUF87; Helicase HerA, central domain (PF01935; HMM-score: 15.3)
    AAA_30; AAA domain (PF13604; HMM-score: 14.9)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 14.6)
    NACHT; NACHT domain (PF05729; HMM-score: 14.5)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 14.4)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 14.3)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 14.3)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 14.1)
    AAA_14; AAA domain (PF13173; HMM-score: 13.3)
    NTPase_1; NTPase (PF03266; HMM-score: 13.2)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 13)
    FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 12.8)
    no clan defined Sua5_yciO_yrdC; Telomere recombination (PF01300; HMM-score: 12.4)
    P-loop_NTPase (CL0023) Pox_A32; Poxvirus A32 protein (PF04665; HMM-score: 12.4)
    AAA_18; AAA domain (PF13238; HMM-score: 12.4)
    DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 12.2)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 11.5)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 10.7)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.2496
    • Cytoplasmic Membrane Score: 0.7482
    • Cell wall & surface Score: 0.0007
    • Extracellular Score: 0.0015
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.022611
    • TAT(Tat/SPI): 0.00035
    • LIPO(Sec/SPII): 0.001355
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTIRFDNVSYTYQKGTPYQHQAIHDVNTEFEQGKYYAIVGQTGSGKSTLIQNINALLKPTTGTVTVDDITITHKTKDKYIRPVRKRIGMVFQFPESQLFEDTVEREMIFGPKNFKMNLDEAKNYAHRLLMDLGFSRDVMSQSPFQMSGGQMRKIAIVSILAMNPDIIVVDEPTAGLDPQSKRQVMRLLKSLQTDENKAIILISHDMNEVARYADEVIVMKEGSIVSQTSPKELFKDKKKLADWHIGLPEIVQLQYDFEQKYQTKLKDIALTEEAFVSLYKEWQHEK

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]

NCBI: 26-AUG-2013

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA2020
  • pan locus tag?: SAUPAN005671000
  • symbol: cbiO
  • pan gene symbol?: cbiO2
  • synonym: ecfA2
  • product: cobalt transporter ATP-binding subunit

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA2020
  • symbol: cbiO
  • product: cobalt transporter ATP-binding subunit
  • replicon: chromosome
  • strand: -
  • coordinates: 2292522..2293382
  • length: 861
  • essential: yes DEG other strains

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    ATGACTATACGGTTTGACAATGTAAGTTATACCTATCAAAAAGGGACACCATATCAGCAT
    CAAGCTATTCATGATGTTAATACAGAATTTGAACAAGGTAAATATTACGCCATCGTTGGA
    CAAACGGGTAGTGGTAAATCAACGTTGATACAAAATATTAATGCGCTGTTAAAGCCGACT
    ACTGGGACAGTTACAGTTGATGACATTACTATTACACATAAGACCAAAGATAAATATATT
    AGACCTGTAAGAAAAAGAATTGGAATGGTATTTCAATTTCCCGAATCTCAATTATTTGAG
    GACACAGTAGAGCGTGAAATGATATTTGGACCTAAAAACTTTAAAATGAATTTAGATGAA
    GCCAAAAACTATGCCCATCGTCTGTTGATGGATTTAGGCTTTTCAAGAGATGTAATGTCA
    CAATCACCATTTCAAATGTCAGGTGGACAAATGCGTAAAATAGCGATTGTATCGATATTG
    GCAATGAATCCTGATATTATCGTGGTTGATGAACCTACAGCAGGACTTGATCCACAAAGT
    AAACGACAAGTAATGAGATTACTAAAGTCACTACAAACAGATGAAAATAAGGCAATTATC
    CTAATTTCACATGATATGAATGAAGTCGCGCGTTATGCAGATGAAGTCATCGTTATGAAA
    GAAGGTAGTATAGTGTCGCAAACATCACCAAAAGAGCTCTTCAAAGATAAAAAAAAATTG
    GCGGATTGGCATATTGGTTTGCCAGAAATTGTTCAGTTACAATATGACTTTGAACAAAAA
    TATCAAACAAAATTAAAAGATATTGCCTTAACTGAAGAAGCATTTGTAAGCTTGTATAAG
    GAGTGGCAACATGAAAAATAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    861

This data comes from external databases and cannot be edited.

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA2020
  • symbol: CbiO
  • description: cobalt transporter ATP-binding subunit
  • length: 286
  • theoretical pI: 7.25591
  • theoretical MW: 32918.6
  • GRAVY: -0.461538

Function[edit | edit source]

  • reaction:
    EC 3.6.3.-?  ExPASy
  • TIGRFAM:
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04521; EC 3.6.3.-; HMM-score: 367.8)
    and 79 more
    Metabolism Transport and binding proteins Unknown substrate energy-coupling factor transporter ATPase (TIGR04520; EC 3.6.3.-; HMM-score: 256.1)
    Metabolism Transport and binding proteins Cations and iron carrying compounds cobalt ABC transporter, ATP-binding protein (TIGR01166; HMM-score: 154.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines glycine betaine/L-proline transport ATP binding subunit (TIGR01186; HMM-score: 153.5)
    Metabolism Transport and binding proteins Anions phosphonate ABC transporter, ATP-binding protein (TIGR02315; EC 3.6.3.28; HMM-score: 152.4)
    Metabolism Transport and binding proteins Anions phosphate ABC transporter, ATP-binding protein (TIGR00972; EC 3.6.3.27; HMM-score: 145)
    Metabolism Transport and binding proteins Other daunorubicin resistance ABC transporter, ATP-binding protein (TIGR01188; HMM-score: 144.3)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikE (TIGR02769; EC 3.6.3.24; HMM-score: 140.9)
    D-methionine ABC transporter, ATP-binding protein (TIGR02314; EC 3.6.3.-; HMM-score: 135.3)
    Metabolism Transport and binding proteins Anions molybdate ABC transporter, ATP-binding protein (TIGR02142; EC 3.6.3.29; HMM-score: 132.7)
    Metabolism Transport and binding proteins Cations and iron carrying compounds nickel import ATP-binding protein NikD (TIGR02770; HMM-score: 130)
    Cellular processes Cellular processes Toxin production and resistance putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 129.1)
    Metabolism Transport and binding proteins Unknown substrate putative bacteriocin export ABC transporter, lactococcin 972 group (TIGR03608; HMM-score: 129.1)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking lipoprotein releasing system, ATP-binding protein (TIGR02211; EC 3.6.3.-; HMM-score: 123.1)
    ABC exporter ATP-binding subunit, DevA family (TIGR02982; HMM-score: 122.5)
    Metabolism Transport and binding proteins Anions sulfate ABC transporter, ATP-binding protein (TIGR00968; EC 3.6.3.25; HMM-score: 122.2)
    Cellular processes Cellular processes Pathogenesis type I secretion system ATPase (TIGR03375; HMM-score: 120.6)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR03375; HMM-score: 120.6)
    Cellular processes Cellular processes Cell division cell division ATP-binding protein FtsE (TIGR02673; HMM-score: 119.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines putative 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TIGR03265; HMM-score: 119.4)
    ectoine/hydroxyectoine ABC transporter, ATP-binding protein EhuA (TIGR03005; HMM-score: 118.9)
    thiol reductant ABC exporter, CydD subunit (TIGR02857; HMM-score: 118)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 115.6)
    Metabolism Transport and binding proteins Other lipid A export permease/ATP-binding protein MsbA (TIGR02203; HMM-score: 115.6)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids ABC transporter, ATP-binding subunit, PQQ-dependent alcohol dehydrogenase system (TIGR03864; HMM-score: 114.1)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01846; HMM-score: 112.4)
    Metabolism Transport and binding proteins Other antigen peptide transporter 2 (TIGR00958; HMM-score: 110.4)
    ABC transporter, permease/ATP-binding protein (TIGR02204; HMM-score: 109.4)
    2-aminoethylphosphonate ABC transport system, ATP-binding component PhnT (TIGR03258; HMM-score: 107.1)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 104.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, ATP-binding protein (TIGR03797; HMM-score: 104.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtE (TIGR03410; HMM-score: 104.3)
    thiol reductant ABC exporter, CydC subunit (TIGR02868; HMM-score: 103.2)
    Metabolism Transport and binding proteins Other thiamine ABC transporter, ATP-binding protein (TIGR01277; EC 3.6.3.-; HMM-score: 100.9)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 98.9)
    Metabolism Transport and binding proteins Other LPS export ABC transporter ATP-binding protein (TIGR04406; HMM-score: 98.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines choline ABC transporter, ATP-binding protein (TIGR03415; HMM-score: 97.7)
    Metabolism Transport and binding proteins Amino acids, peptides and amines polyamine ABC transporter, ATP-binding protein (TIGR01187; EC 3.6.3.31; HMM-score: 95.9)
    Metabolism Transport and binding proteins Amino acids, peptides and amines urea ABC transporter, ATP-binding protein UrtD (TIGR03411; HMM-score: 95.9)
    Metabolism Energy metabolism Methanogenesis methyl coenzyme M reductase system, component A2 (TIGR03269; HMM-score: 94.9)
    Cellular processes Cellular processes Biosynthesis of natural products NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 93.4)
    Metabolism Transport and binding proteins Amino acids, peptides and amines NHLM bacteriocin system ABC transporter, peptidase/ATP-binding protein (TIGR03796; HMM-score: 93.4)
    gliding motility-associated ABC transporter ATP-binding subunit GldA (TIGR03522; HMM-score: 92.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking ABC-type bacteriocin transporter (TIGR01193; HMM-score: 91.4)
    Genetic information processing Protein fate Protein modification and repair ABC-type bacteriocin transporter (TIGR01193; HMM-score: 91.4)
    Metabolism Transport and binding proteins Other ABC-type bacteriocin transporter (TIGR01193; HMM-score: 91.4)
    Cellular processes Cellular processes Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 88.9)
    Metabolism Transport and binding proteins Other nodulation ABC transporter NodI (TIGR01288; HMM-score: 88.9)
    proposed F420-0 ABC transporter, ATP-binding protein (TIGR03873; HMM-score: 86.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking type I secretion system ATPase (TIGR01842; HMM-score: 83.9)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids glucan exporter ATP-binding protein (TIGR01192; EC 3.6.3.42; HMM-score: 82.6)
    Metabolism Transport and binding proteins Other pigment precursor permease (TIGR00955; HMM-score: 81.3)
    lantibiotic protection ABC transporter, ATP-binding subunit (TIGR03740; HMM-score: 78.6)
    phosphonate C-P lyase system protein PhnL (TIGR02324; HMM-score: 77)
    Metabolism Transport and binding proteins Anions nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 76.5)
    Metabolism Transport and binding proteins Other nitrate ABC transporter, ATP-binding proteins C and D (TIGR01184; HMM-score: 76.5)
    Metabolism Transport and binding proteins Unknown substrate anchored repeat-type ABC transporter, ATP-binding subunit (TIGR03771; HMM-score: 74.6)
    Metabolism Transport and binding proteins Amino acids, peptides and amines cyclic peptide transporter (TIGR01194; HMM-score: 72.6)
    Metabolism Transport and binding proteins Other cyclic peptide transporter (TIGR01194; HMM-score: 72.6)
    Metabolism Transport and binding proteins Other rim ABC transporter (TIGR01257; HMM-score: 72.1)
    Metabolism Central intermediary metabolism Phosphorus compounds phosphonate C-P lyase system protein PhnK (TIGR02323; HMM-score: 68.9)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids D-xylose ABC transporter, ATP-binding protein (TIGR02633; EC 3.6.3.17; HMM-score: 66.8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other FeS assembly ATPase SufC (TIGR01978; HMM-score: 66.4)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 56.3)
    Metabolism Transport and binding proteins Other heme ABC exporter, ATP-binding protein CcmA (TIGR01189; EC 3.6.3.41; HMM-score: 56.3)
    ATP-binding cassette protein, ChvD family (TIGR03719; HMM-score: 51.3)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair excinuclease ABC subunit A (TIGR00630; EC 3.1.25.-; HMM-score: 46.7)
    Metabolism Transport and binding proteins Other pleiotropic drug resistance family protein (TIGR00956; HMM-score: 42.6)
    Metabolism Transport and binding proteins Other multi drug resistance-associated protein (MRP) (TIGR00957; HMM-score: 38.8)
    Metabolism Transport and binding proteins Anions cystic fibrosis transmembrane conductor regulator (CFTR) (TIGR01271; EC 3.6.3.49; HMM-score: 35.4)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair DNA repair protein RecN (TIGR00634; HMM-score: 20.8)
    Genetic information processing Protein fate Protein and peptide secretion and trafficking putative secretion ATPase, PEP-CTERM locus subfamily (TIGR03015; HMM-score: 18.7)
    Metabolism Transport and binding proteins Carbohydrates, organic alcohols, and acids peroxysomal long chain fatty acyl transporter (TIGR00954; HMM-score: 17.9)
    Genetic information processing Protein synthesis Translation factors ribosome small subunit-dependent GTPase A (TIGR00157; EC 3.6.-.-; HMM-score: 16.1)
    Cellular processes Cellular processes Chemotaxis and motility flagellar biosynthesis protein FlhF (TIGR03499; HMM-score: 15.5)
    helicase/secretion neighborhood ATPase (TIGR03819; HMM-score: 13.3)
    Genetic information processing DNA metabolism DNA replication, recombination, and repair exonuclease SbcC (TIGR00618; HMM-score: 13.1)
    Metabolism Purines, pyrimidines, nucleosides, and nucleotides Nucleotide and nucleoside interconversions dTMP kinase (TIGR00041; EC 2.7.4.9; HMM-score: 13)
    Genetic information processing Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 13)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA 2-selenouridine synthase (TIGR03167; EC 2.9.1.-; HMM-score: 12.1)
  • TheSEED  :
    • ECF transporter, ATPase component of energizing module
    Cofactors, Vitamins, Prosthetic Groups, Pigments Folate and pterines Folate Biosynthesis  ATPase component of general energizing module of ECF transporters
    and 1 more
    Membrane Transport Membrane Transport - no subcategory ECF class transporters  ATPase component of general energizing module of ECF transporters
  • PFAM:
    P-loop_NTPase (CL0023) ABC_tran; ABC transporter (PF00005; HMM-score: 101.6)
    and 36 more
    AAA_21; AAA domain, putative AbiEii toxin, Type IV TA system (PF13304; HMM-score: 48.1)
    SMC_N; RecF/RecN/SMC N terminal domain (PF02463; HMM-score: 36.2)
    AAA_29; P-loop containing region of AAA domain (PF13555; HMM-score: 28.7)
    AAA_15; AAA ATPase domain (PF13175; HMM-score: 27)
    RsgA_GTPase; RsgA GTPase (PF03193; HMM-score: 24.9)
    ResIII; Type III restriction enzyme, res subunit (PF04851; HMM-score: 22.6)
    AAA_22; AAA domain (PF13401; HMM-score: 21.8)
    DEAD; DEAD/DEAH box helicase (PF00270; HMM-score: 21.3)
    AAA_23; AAA domain (PF13476; HMM-score: 19)
    MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 18)
    Zeta_toxin; Zeta toxin (PF06414; HMM-score: 17.9)
    SbcC_Walker_B; SbcC/RAD50-like, Walker B motif (PF13558; HMM-score: 16.7)
    nSTAND3; Novel STAND NTPase 3 (PF20720; HMM-score: 16.7)
    Dynamin_N; Dynamin family (PF00350; HMM-score: 16)
    ABC_ATPase; P-loop domain (PF09818; HMM-score: 16)
    AAA_19; AAA domain (PF13245; HMM-score: 15.9)
    AAA_7; P-loop containing dynein motor region (PF12775; HMM-score: 15.8)
    T2SSE; Type II/IV secretion system protein (PF00437; HMM-score: 15.6)
    DUF87; Helicase HerA, central domain (PF01935; HMM-score: 15.3)
    AAA_30; AAA domain (PF13604; HMM-score: 14.9)
    TniB; Bacterial TniB protein (PF05621; HMM-score: 14.6)
    NACHT; NACHT domain (PF05729; HMM-score: 14.5)
    AAA_16; AAA ATPase domain (PF13191; HMM-score: 14.4)
    RNA_helicase; RNA helicase (PF00910; HMM-score: 14.3)
    NB-ARC; NB-ARC domain (PF00931; HMM-score: 14.3)
    AAA_5; AAA domain (dynein-related subfamily) (PF07728; HMM-score: 14.1)
    AAA_14; AAA domain (PF13173; HMM-score: 13.3)
    NTPase_1; NTPase (PF03266; HMM-score: 13.2)
    AAA; ATPase family associated with various cellular activities (AAA) (PF00004; HMM-score: 13)
    FtsK_SpoIIIE; FtsK/SpoIIIE family (PF01580; HMM-score: 12.8)
    no clan defined Sua5_yciO_yrdC; Telomere recombination (PF01300; HMM-score: 12.4)
    P-loop_NTPase (CL0023) Pox_A32; Poxvirus A32 protein (PF04665; HMM-score: 12.4)
    AAA_18; AAA domain (PF13238; HMM-score: 12.4)
    DUF5906; Family of unknown function (DUF5906) (PF19263; HMM-score: 12.2)
    Mg_chelatase; Magnesium chelatase, subunit ChlI (PF01078; HMM-score: 11.5)
    cobW; CobW/HypB/UreG, nucleotide-binding domain (PF02492; HMM-score: 10.7)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 0
  • DeepLocPro: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.2496
    • Cytoplasmic Membrane Score: 0.7482
    • Cell wall & surface Score: 0.0007
    • Extracellular Score: 0.0015
  • LocateP: Intracellular
    • Prediction by SwissProt Classification: Cytoplasmic
    • Pathway Prediction: No pathway
    • Intracellular possibility: 1
    • Signal peptide possibility: -1
    • N-terminally Anchored Score: 1
    • Predicted Cleavage Site: No CleavageSite
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.022611
    • TAT(Tat/SPI): 0.00035
    • LIPO(Sec/SPII): 0.001355
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MTIRFDNVSYTYQKGTPYQHQAIHDVNTEFEQGKYYAIVGQTGSGKSTLIQNINALLKPTTGTVTVDDITITHKTKDKYIRPVRKRIGMVFQFPESQLFEDTVEREMIFGPKNFKMNLDEAKNYAHRLLMDLGFSRDVMSQSPFQMSGGQMRKIAIVSILAMNPDIIVVDEPTAGLDPQSKRQVMRLLKSLQTDENKAIILISHDMNEVARYADEVIVMKEGSIVSQTSPKELFKDKKKLADWHIGLPEIVQLQYDFEQKYQTKLKDIALTEEAFVSLYKEWQHEK

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

This data comes from external databases and cannot be edited.

Other Information[edit | edit source]

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]