UndoCtrl+ZRedoCtrl+Shift+Z, Ctrl+Y
LinkCtrl+K

Links

Link important words to other wiki articles or even other websites. It will help readers understand the context.

Okay, got it
Special character
Edit notices
Save changes…Alt+S
ParagraphCtrl+0HeadingCtrl+2Sub-heading 1Ctrl+3Sub-heading 2Ctrl+4Sub-heading 3Ctrl+5Sub-heading 4Ctrl+6Header cellContent cellPreformattedCtrl+7Block quoteCtrl+8Page titleCtrl+1
BoldCtrl+BItalicCtrl+ISuperscriptCtrl+.SubscriptCtrl+,Computer codeCtrl+Shift+6StrikethroughCtrl+Shift+5UnderlineCtrl+UBigSmallLanguageRemoveCtrl+\, Ctrl+MMore
PubMedBasicCtrl+Shift+KRe-useMore
Bullet listNumbered listDecrease indentationShift+Tab, Ctrl+[Increase indentationTab, Ctrl+]More
Images and mediaTemplateTableCommentGalleryYour signatureReferences listMore
Read the user guideKeyboard shortcutsCtrl+/, Ctrl+Shift+/Toolbar searchCtrl+Shift+P, Ctrl+Alt+Shift+P
More
2 noticesClose
Warning: You are not logged in. Your IP address will be publicly visible if you make any edits. If you log in or create an account, your edits will be attributed to your username, along with other benefits.

You are using a browser which is not officially supported by this editor.

OptionsCategoriesPage settingsAdvanced settingsLanguagesTemplates used⧼visualeditor-changedir-rtl⧽Ctrl+Shift+XFind and replaceCtrl+FMore
Visual editingSource editingMore
From AureoWiki
Jump to navigation Jump to search

NCBI: 26-AUG-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SAtRNA07 [new locus tag: SA_RS02750 ]
  • pan locus tag?: SAUPAN002267000
  • symbol: SAtRNA07
  • pan gene symbol?: trnaT
  • synonym:
  • product: tRNA-Thr

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: tRNA
  • locus tag: SAtRNA07 [new locus tag: SA_RS02750 ]
  • symbol: SAtRNA07
  • product: tRNA-Thr
  • replicon: chromosome
  • strand: +
  • coordinates: 549835..549910
  • length: 76
  • essential: unknown

⊟Accession numbers[edit | edit source]

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    GCCGGCCTAGCTCAATTGGTAGAGCAACTGACTTGTAATCAGTAGGTTGGGGGTTCAAGT
    CCTCTGGCCGGCACCA
    60
    76

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAtRNA07 [new locus tag: SA_RS02750 ]
  • symbol: SAtRNA07
  • description: tRNA-Thr
  • length:
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

⊟Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb:
  • DeepLocPro:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

⊟Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

⊟Protein sequence[edit | edit source]

⊟Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊞Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊞Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

⊟Relevant publications[edit | edit source]

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=SAtRNA07&oldid=102061"
Insert paragraph

NCBI: 26-AUG-2013

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SAtRNA07 [new locus tag: SA_RS02750 ]
  • pan locus tag?: SAUPAN002267000
  • symbol: SAtRNA07
  • pan gene symbol?: trnaT
  • synonym:
  • product: tRNA-Thr

Insert paragraph

⊟Genome View[edit | edit source]

Insert paragraph

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: tRNA
  • locus tag: SAtRNA07 [new locus tag: SA_RS02750 ]
  • symbol: SAtRNA07
  • product: tRNA-Thr
  • replicon: chromosome
  • strand: +
  • coordinates: 549835..549910
  • length: 76
  • essential: unknown

Insert paragraph

⊟Accession numbers[edit | edit source]

Insert paragraph

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    GCCGGCCTAGCTCAATTGGTAGAGCAACTGACTTGTAATCAGTAGGTTGGGGGTTCAAGT
    CCTCTGGCCGGCACCA
    60
    76

Insert paragraph

This data comes from external databases and cannot be edited.

Insert paragraph

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SAtRNA07 [new locus tag: SA_RS02750 ]
  • symbol: SAtRNA07
  • description: tRNA-Thr
  • length:
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

Insert paragraph

⊟Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:

Insert paragraph

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Insert paragraph

⊟Localization[edit | edit source]

  • PSORTb:
  • DeepLocPro:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Insert paragraph

⊟Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

Insert paragraph

⊟Protein sequence[edit | edit source]

Insert paragraph

⊟Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Insert paragraph

⊟Expression & Regulation[edit | edit source]

Insert paragraph

⊟Operon[edit | edit source]

Insert paragraph

⊟Regulation[edit | edit source]

  • regulator:

Insert paragraph

⊟Transcription pattern[edit | edit source]

Insert paragraph

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

Insert paragraph

⊟Protein stability[edit | edit source]

  • half-life: no data available

Insert paragraph

⊞Biological Material[edit | edit source]

This data comes from external databases and cannot be edited.

This data comes from external databases and cannot be edited.

This data comes from external databases and cannot be edited.

This data comes from external databases and cannot be edited.

This data comes from external databases and cannot be edited.

This data comes from external databases and cannot be edited.

This data comes from external databases and cannot be edited.

⊞Other Information[edit | edit source]

⊟Literature[edit | edit source]

⊟References[edit | edit source]

Insert paragraph

⊟Relevant publications[edit | edit source]

Insert paragraph