From AureoWiki
Jump to navigation Jump to search

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: tRNA
  • locus tag: SACOL_RS11310 [old locus tag: SACOL_tRNA-Asn-3 ]
  • symbol: SACOL_RS11310
  • product: tRNA-Asn
  • replicon: chromosome
  • strand: -
  • coordinates: 2228412..2228486
  • length: 75
  • essential: unknown

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    TCCACAGTAGCTCAGTGGTAGAGCTATCGGCTGTTAACCGATCGGTCGTAGGTTCGAGTC
    CTACCTGTGGAGCCA
    60
    75

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS11310 [old locus tag: SACOL_tRNA-Asn-3 ]
  • symbol: SACOL_RS11310
  • description: tRNA-Asn
  • length:
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb:
  • DeepLocPro:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit | edit source]

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus COL
  • locus tag: SACOL_RS11310 [old locus tag: SACOL_tRNA-Asn-3 ]
  • pan locus tag?: SAUPAN005524000
  • symbol: SACOL_RS11310
  • pan gene symbol?: trnaN
  • synonym:
  • product: tRNA-Asn

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: tRNA
  • locus tag: SACOL_RS11310 [old locus tag: SACOL_tRNA-Asn-3 ]
  • symbol: SACOL_RS11310
  • product: tRNA-Asn
  • replicon: chromosome
  • strand: -
  • coordinates: 2228412..2228486
  • length: 75
  • essential: unknown

Accession numbers[edit | edit source]

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    TCCACAGTAGCTCAGTGGTAGAGCTATCGGCTGTTAACCGATCGGTCGTAGGTTCGAGTC
    CTACCTGTGGAGCCA
    60
    75

This data comes from external databases and cannot be edited.

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SACOL_RS11310 [old locus tag: SACOL_tRNA-Asn-3 ]
  • symbol: SACOL_RS11310
  • description: tRNA-Asn
  • length:
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

Localization[edit | edit source]

  • PSORTb:
  • DeepLocPro:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Accession numbers[edit | edit source]

  • GI:
  • RefSeq:
  • UniProt:

Protein sequence[edit | edit source]

Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

This data comes from external databases and cannot be edited.

This data comes from external databases and cannot be edited.

This data comes from external databases and cannot be edited.

This data comes from external databases and cannot be edited.

This data comes from external databases and cannot be edited.

This data comes from external databases and cannot be edited.

This data comes from external databases and cannot be edited.

Other Information[edit | edit source]

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]