From AureoWiki
Revision as of 17:07, 10 March 2016 by AureoSysAdmin (talk | contribs) (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
Jump to navigation Jump to search

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: tRNA
  • locus tag: SA_RS11300 [old locus tag: SAtRNA58 ]
  • symbol: SA_RS11300
  • product: tRNA-Gln
  • replicon: chromosome
  • strand: -
  • coordinates: 2230304..2230378
  • length: 75
  • essential: unknown

Accession numbers[edit | edit source]

  • Gene ID:
  • gene Genbank : _

Phenotype[edit | edit source]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    TGGGCTATAGCCAAGCGGTAAGGCAACGGACTTTGACTCCGTCACTCGTTGGTTCGAATC
    CAGCTAGCCCAGCCA
    60
    75

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS11300 [old locus tag: SAtRNA58 ]
  • symbol: SA_RS11300
  • description: tRNA-Gln
  • length:
  • theoretical pI:
  • theoretical MW:
  • GRAVY:

Function[edit | edit source]

  • TIGRFAM:
  • TheSEED:
  • PFAM:

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • interaction partners:

Localization[edit | edit source]

  • PSORTb:
  • LocateP:
  • SignalP:
  • predicted transmembrane helices (TMHMM):

Accession numbers[edit | edit source]

  • GI:
  • UniProt:
  • RefSeq:

Protein sequence[edit | edit source]

Peptides[edit | edit source]

  • experimentally validated:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • sigma factors : _
  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]