From AureoWiki
Jump to navigation Jump to search
VisualWikitext
m (Text replacement - "gene Genbank" to "gene RefSeq")
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "")
 
Line 1: Line 1:
__TOC__
<protect>
<protect>
<aureodatabase>NCBI date</aureodatabase>
<aureodatabase>annotation</aureodatabase>


=Summary=
=Summary=


* <aureodatabase>organism</aureodatabase>
*<aureodatabase>organism</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>pan locus</aureodatabase>
*<aureodatabase>pan locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>pan gene symbol</aureodatabase>
*<aureodatabase>pan gene symbol</aureodatabase>
* <aureodatabase>gene synonyms</aureodatabase>
*<aureodatabase>gene synonyms</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
</protect>
</protect>


Line 24: Line 25:
==General==
==General==


* <aureodatabase>gene type</aureodatabase>
*<aureodatabase>gene type</aureodatabase>
* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>gene symbol</aureodatabase>
*<aureodatabase>gene symbol</aureodatabase>
* <aureodatabase>product</aureodatabase>
*<aureodatabase>product</aureodatabase>
* <aureodatabase>gene replicon</aureodatabase>
*<aureodatabase>gene replicon</aureodatabase>
* <aureodatabase>strand</aureodatabase>
*<aureodatabase>strand</aureodatabase>
* <aureodatabase>gene coordinates</aureodatabase>
*<aureodatabase>gene coordinates</aureodatabase>
* <aureodatabase>gene length</aureodatabase>
*<aureodatabase>gene length</aureodatabase>
* <aureodatabase>essential</aureodatabase>
*<aureodatabase>essential</aureodatabase>
*<aureodatabase>gene comment</aureodatabase>
</protect>
</protect>


Line 38: Line 40:
==Accession numbers==
==Accession numbers==


* <aureodatabase>gene GI</aureodatabase>
*<aureodatabase>gene location</aureodatabase>
* <aureodatabase>gene RefSeq</aureodatabase>
*<aureodatabase>gene BioCyc</aureodatabase>
*<aureodatabase>gene MicrobesOnline</aureodatabase>
</protect>
</protect>
   
   
<protect>  
<protect>
==Phenotype==
==Phenotype==
</protect>
</protect>
* Share your knowledge and add information here. [<span class="plainlinks">[http://www.protecs.uni-greifswald.de/aureowiki/index.php?title={{PAGENAMEE}}&action=edit&section=6 edit]</span>]
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit&section=6 edit]</span>]


<protect>
<protect>
==DNA sequence==
==DNA sequence==


* <aureodatabase>gene sequence</aureodatabase>
*<aureodatabase>gene sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
<aureodatabase>RNA regulated operons</aureodatabase>
</protect>


<protect>
=Protein=
=Protein=
<aureodatabase>protein 3D view</aureodatabase>
<aureodatabase>protein 3D view</aureodatabase>
==General==
==General==


* <aureodatabase>locus</aureodatabase>
*<aureodatabase>locus</aureodatabase>
* <aureodatabase>protein symbol</aureodatabase>
*<aureodatabase>protein symbol</aureodatabase>
* <aureodatabase>protein description</aureodatabase>
*<aureodatabase>protein description</aureodatabase>
* <aureodatabase>protein length</aureodatabase>
*<aureodatabase>protein length</aureodatabase>
* <aureodatabase>theoretical pI</aureodatabase>
*<aureodatabase>theoretical pI</aureodatabase>
* <aureodatabase>theoretical MW</aureodatabase>
*<aureodatabase>theoretical MW</aureodatabase>
* <aureodatabase>GRAVY</aureodatabase>
*<aureodatabase>GRAVY</aureodatabase>
</protect>
</protect>


Line 71: Line 77:
==Function==
==Function==


* <aureodatabase>protein reaction</aureodatabase>
*<aureodatabase>protein reaction</aureodatabase>
* <aureodatabase>protein TIGRFAM</aureodatabase>
*<aureodatabase>protein TIGRFAM</aureodatabase>
* <aureodatabase>protein TheSeed</aureodatabase>
*<aureodatabase>protein TheSeed</aureodatabase>
* <aureodatabase>protein PFAM</aureodatabase>
*<aureodatabase>protein PFAM</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Structure, modifications & interactions==
==Structure, modifications & cofactors==


* <aureodatabase>protein domains</aureodatabase>
*<aureodatabase>protein domains</aureodatabase>
* <aureodatabase>protein modifications</aureodatabase>
*<aureodatabase>protein modifications</aureodatabase>
* <aureodatabase>protein cofactors</aureodatabase>
*<aureodatabase>protein cofactors</aureodatabase>
* <aureodatabase>protein effectors</aureodatabase>
*<aureodatabase>protein effectors</aureodatabase>
* <aureodatabase>protein partners</aureodatabase>
*<aureodatabase>protein regulated operons</aureodatabase>
</protect>
</protect>


Line 90: Line 96:
==Localization==
==Localization==


* <aureodatabase>protein Psortb</aureodatabase>
*<aureodatabase>protein Psortb</aureodatabase>
* <aureodatabase>protein LocateP</aureodatabase>
*<aureodatabase>protein LocateP</aureodatabase>
* <aureodatabase>protein SignalP</aureodatabase>
*<aureodatabase>protein SignalP</aureodatabase>
* <aureodatabase>protein TMHMM</aureodatabase>
*<aureodatabase>protein TMHMM</aureodatabase>
</protect>
</protect>


Line 99: Line 105:
==Accession numbers==
==Accession numbers==


* <aureodatabase>protein GI</aureodatabase>
*<aureodatabase>protein GI</aureodatabase>
* <aureodatabase>protein UniProt</aureodatabase>
*<aureodatabase>protein RefSeq</aureodatabase>
* <aureodatabase>protein Genbank</aureodatabase>
*<aureodatabase>protein UniProt</aureodatabase>
* <aureodatabase>protein RefSeq</aureodatabase>
</protect>
</protect>


Line 108: Line 113:
==Protein sequence==
==Protein sequence==


* <aureodatabase>protein sequence</aureodatabase>
*<aureodatabase>protein sequence</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Peptides==
==Experimental data==


* <aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated peptides</aureodatabase>
*<aureodatabase>protein validated localization</aureodatabase>
*<aureodatabase>protein validated quantitative data</aureodatabase>
*<aureodatabase>protein partners</aureodatabase>
</protect>
</protect>


Line 125: Line 133:
==Operon==
==Operon==


* <aureodatabase>operons</aureodatabase>
*<aureodatabase>operons</aureodatabase>
</protect>
</protect>


Line 131: Line 139:
==Regulation==
==Regulation==


* <aureodatabase>sigma factors</aureodatabase>
*<aureodatabase>regulators</aureodatabase>
* <aureodatabase>regulators</aureodatabase>
</protect>
</protect>


Line 138: Line 145:
==Transcription pattern==
==Transcription pattern==


* <aureodatabase>expression browser</aureodatabase>
*<aureodatabase>expression browser</aureodatabase>
</protect>
</protect>


Line 144: Line 151:
==Protein synthesis (provided by Aureolib)==
==Protein synthesis (provided by Aureolib)==


* <aureodatabase>protein synthesis Aureolib</aureodatabase>
*<aureodatabase>protein synthesis Aureolib</aureodatabase>
</protect>
</protect>


<protect>
<protect>
==Stability==
==Protein stability==


* <aureodatabase>protein half-life</aureodatabase>
*<aureodatabase>protein half-life</aureodatabase>
</protect>
</protect>


Latest revision as of 09:36, 11 March 2016

PangenomeCOLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

NCBI: 02-MAR-2017

⊟Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS10130 [old locus tag: SA1762 ]
  • pan locus tag?: SAUPAN005041000
  • symbol: SA_RS10130
  • pan gene symbol?: —
  • synonym:
  • product: hypothetical protein

⊟Genome View[edit | edit source]

⊟Gene[edit | edit source]

⊟General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS10130 [old locus tag: SA1762 ]
  • symbol: SA_RS10130
  • product: hypothetical protein
  • replicon: chromosome
  • strand: -
  • coordinates: 2012574..2012948
  • length: 375
  • essential: no DEG

⊟Accession numbers[edit | edit source]

  • Location: NC_002745 (2012574..2012948) NCBI
  • BioCyc: G1G21-2045 BioCyc
  • MicrobesOnline: see SA1762

⊟Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

⊟DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    TTGGATGATATTCAGAAAATAAAAAAAGAGCTTTCTGAATTAGTTGAACGTGTTGATGAT
    GTTGAAATACTAGCAAACGAAACAGCTGATCATGTGCTTGAACTTAGAGAGGAACATAAG
    CAACATCATAATGAACTAAGAGAATCTCATAAAGAACTTAAAGATAAGCAAGATAAAGTT
    GTAGATGAGAATTTAGAGCAAACAAAGATATTAAACAGAATTGAAGAAAGATATCAAACG
    CAAGTAGATGTTGCGCAAAAAAATGAAGAAAAGACACTCGCCCAAAATAAATGGCTCGTA
    GGTGCCATATGGGCGCTTGTAACAATTGTTATGATTGCAGTCATTACTGCATCAATTACT
    GCGTTATTACCTTAA
    60
    120
    180
    240
    300
    360
    375

⊟Protein[edit | edit source]

⊟General[edit | edit source]

  • locus tag: SA_RS10130 [old locus tag: SA1762 ]
  • symbol: SA_RS10130
  • description: hypothetical protein
  • length: 124
  • theoretical pI: 4.77438
  • theoretical MW: 14429.3
  • GRAVY: -0.557258

⊟Function[edit | edit source]

  • TIGRFAM:
    SH3 domain protein (TIGR04211; HMM-score: 17)
    and 5 more
    Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02168; HMM-score: 12.5)
    Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02168; HMM-score: 12.5)
    Cellular processes Cellular processes Cell division chromosome segregation protein SMC (TIGR02169; HMM-score: 9.9)
    Genetic information processing DNA metabolism Chromosome-associated proteins chromosome segregation protein SMC (TIGR02169; HMM-score: 9.9)
    Genetic information processing Protein synthesis tRNA aminoacylation serine--tRNA ligase (TIGR00414; EC 6.1.1.11; HMM-score: 9)
  • TheSEED: see SA1762
  • PFAM:
    no clan defined PHA_synth_III_E; Poly(R)-hydroxyalkanoic acid synthase subunit (PHA_synth_III_E) (PF09712; HMM-score: 18.4)
    CheZ; Chemotaxis phosphatase, CheZ (PF04344; HMM-score: 16.6)
    and 15 more
    Ion_channel (CL0030) Lig_chan; Ligand-gated ion channel (PF00060; HMM-score: 14.4)
    no clan defined Spt5_N; Spt5 transcription elongation factor, acidic N-terminal (PF11942; HMM-score: 14.3)
    US6; Viral unique short region 6 (PF17616; HMM-score: 13.4)
    YtxH; YtxH-like protein (PF12732; HMM-score: 13.3)
    DAG1; Dystroglycan (Dystrophin-associated glycoprotein 1) (PF05454; HMM-score: 12.8)
    TMPIT; TMPIT-like protein (PF07851; HMM-score: 11.8)
    GST_C (CL0497) GST_C; Glutathione S-transferase, C-terminal domain (PF00043; HMM-score: 11.1)
    no clan defined DHHA1; DHHA1 domain (PF02272; HMM-score: 11)
    TPR_MLP1_2; TPR/MLP1/MLP2-like protein (PF07926; HMM-score: 10.8)
    DUF724; Protein of unknown function (DUF724) (PF05266; HMM-score: 10.7)
    zf-C4H2; Zinc finger-containing protein (PF10146; HMM-score: 9.7)
    V_ATPase_I; V-type ATPase 116kDa subunit family (PF01496; HMM-score: 8.6)
    YjbJ-CsbD-like (CL0406) DUF883; Bacterial protein of unknown function (DUF883) (PF05957; HMM-score: 8.1)
    no clan defined Fib_alpha; Fibrinogen alpha/beta chain family (PF08702; HMM-score: 6.3)
    DUF1664; Protein of unknown function (DUF1664) (PF07889; HMM-score: 6.2)

⊟Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:

⊟Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 7.5
    • Cytoplasmic Membrane Score: 1.15
    • Cellwall Score: 0.62
    • Extracellular Score: 0.73
    • Internal Helix: 1
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.001774
    • TAT(Tat/SPI): 0.001282
    • LIPO(Sec/SPII): 0.000299
  • predicted transmembrane helices (TMHMM): 1

⊟Accession numbers[edit | edit source]

⊟Protein sequence[edit | edit source]

  • MDDIQKIKKELSELVERVDDVEILANETADHVLELREEHKQHHNELRESHKELKDKQDKVVDENLEQTKILNRIEERYQTQVDVAQKNEEKTLAQNKWLVGAIWALVTIVMIAVITASITALLP

⊟Experimental data[edit | edit source]

  • experimentally validated:
  • protein localization:
  • quantitative data / protein copy number per cell:
  • interaction partners:

⊟Expression & Regulation[edit | edit source]

⊟Operon[edit | edit source]

⊟Regulation[edit | edit source]

  • regulator:

⊟Transcription pattern[edit | edit source]

⊟Protein synthesis (provided by Aureolib)[edit | edit source]

⊟Protein stability[edit | edit source]

  • half-life: no data available

⊟Biological Material[edit | edit source]

⊟Mutants[edit | edit source]

⊟Expression vector[edit | edit source]

⊟lacZ fusion[edit | edit source]

⊟GFP fusion[edit | edit source]

⊟two-hybrid system[edit | edit source]

⊟FLAG-tag construct[edit | edit source]

⊟Antibody[edit | edit source]

⊟Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

⊟Literature[edit | edit source]

⊟References[edit | edit source]

⊟Relevant publications[edit | edit source]

Retrieved from "http://fungenwikiserver.biologie.uni-greifswald.de/aureowiki/index.php?title=SA_RS10130&oldid=93691"