From AureoWiki
Revision as of 17:12, 10 March 2016 by AureoSysAdmin (talk | contribs) (Text replacement - "gene Genbank" to "gene RefSeq")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

NCBI: 02-MAR-2017

Summary[edit | edit source]

  • organism: Staphylococcus aureus N315
  • locus tag: SA_RS05365 [old locus tag: SA0946 ]
  • pan locus tag?: SAUPAN003320000
  • symbol: SA_RS05365
  • pan gene symbol?: pdhD
  • synonym:
  • product: dihydrolipoyl dehydrogenase

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SA_RS05365 [old locus tag: SA0946 ]
  • symbol: SA_RS05365
  • product: dihydrolipoyl dehydrogenase
  • replicon: chromosome
  • strand: +
  • coordinates: 1074322..1075728
  • length: 1407
  • essential: yes [1] DEG other strains

Accession numbers[edit | edit source]

  • Location: NC_002745 (1074322..1075728) NCBI
  • BioCyc: G1G21-1081 BioCyc
  • MicrobesOnline: see SA0946

Phenotype[edit | edit source]

Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    361
    421
    481
    541
    601
    661
    721
    781
    841
    901
    961
    1021
    1081
    1141
    1201
    1261
    1321
    1381
    ATGGTAGTTGGAGATTTCCCAATTGAAACAGATACTATAGTAATCGGAGCAGGTCCTGGT
    GGATACGTTGCAGCAATTCGTGCAGCTCAATTAGGACAAAAAGTAACAATCGTTGAGAAA
    GGTAATCTTGGTGGTGTTTGCTTAAACGTAGGATGTATTCCTTCAAAAGCATTACTACAT
    GCTTCTCACCGTTTTGTTGAAGCACAACATTCTGAAAACTTAGGTGTTATTGCTGAAAGT
    GTTTCTTTAAACTTCCAAAAAGTTCAAGAATTCAAATCATCAGTTGTTAATAAATTAACT
    GGTGGTGTTGAAGGCTTACTTAAAGGTAACAAAGTTAACATCGTTAAAGGTGAAGCATAT
    TTCGTAGATAACAATAGCTTACGTGTTATGGACGAAAAGAGCGCACAAACATACAACTTT
    AAAAATGCAATCATTGCAACAGGTTCAAGACCAATTGAAATTCCTAATTTCAAATTCGGT
    AAACGTGTTATCGACTCAACAGGTGCTTTAAACTTACAAGAAGTACCAGGTAAATTAGTT
    GTAGTTGGTGGAGGATACATTGGATCAGAATTAGGTACAGCATTTGCTAACTTTGGTTCA
    GAAGTAACCATCCTTGAAGGTGCTAAAGATATCTTAGGTGGCTTCGAAAAACAAATGACA
    CAACCTGTTAAAAAAGGTATGAAAGAAAAAGGTGTTGAAATCGTTACTGAAGCTATGGCT
    AAATCAGCTGAAGAAACAGATAACGGAGTTAAAGTTACTTATGAAGCTAAAGGCGAAGAG
    AAAACAATCGAAGCTGATTATGTATTAGTAACTGTAGGTCGTCGTCCAAACACAGACGAA
    TTAGGCCTAGAAGAATTAGGTGTTAAATTCGCTGACCGTGGATTATTAGAAGTTGATAAA
    CAAAGCCGTACGTCTATCAGCAATATCTATGCAATTGGTGATATCGTTCCAGGTTTACCA
    CTTGCTCACAAAGCTAGCTATGAAGCTAAAGTTGCTGCTGAAGCAATTGATGGTCAAGCT
    GCTGAAGTTGATTACATTGGTATGCCAGCAGTATGCTTTACTGAACCAGAATTAGCTACA
    GTTGGTTATTCAGAAGCGCAAGCTAAAGAAGAAGGTTTAGCAATTAAAGCTTCTAAATTC
    CCATATGCAGCAAATGGTCGTGCATTATCATTAGATGATACTAACGGATTTGTTAAACTT
    ATTACACTTAAAGAAGATGATACTTTAATCGGTGCTCAAGTAGTTGGTACTGGTGCATCA
    GATATTATCTCTGAATTAGGTTTAGCAATTGAAGCTGGTATGAATGCTGAAGATATCGCA
    TTAACAATCCATGCACATCCAACATTAGGTGAGATGACTATGGAAGCAGCAGAAAAAGCT
    ATCGGATACCCAATCCATACAATGTAA
    60
    120
    180
    240
    300
    360
    420
    480
    540
    600
    660
    720
    780
    840
    900
    960
    1020
    1080
    1140
    1200
    1260
    1320
    1380
    1407

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SA_RS05365 [old locus tag: SA0946 ]
  • symbol: SA_RS05365
  • description: dihydrolipoyl dehydrogenase
  • length: 468
  • theoretical pI: 4.66989
  • theoretical MW: 49451
  • GRAVY: -0.00641026

Function[edit | edit source]

  • reaction:
    EC 1.8.1.4?  ExPASy
    Dihydrolipoyl dehydrogenase Protein N6-(dihydrolipoyl)lysine + NAD+ = protein N6-(lipoyl)lysine + NADH
  • TIGRFAM:
    dihydrolipoyl dehydrogenase (TIGR01350; EC 1.8.1.4; HMM-score: 565.5)
    and 42 more
    Cellular processes Cellular processes Detoxification mercury(II) reductase (TIGR02053; EC 1.16.1.1; HMM-score: 369.4)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01424; EC 1.8.1.7; HMM-score: 286.6)
    Metabolism Energy metabolism Electron transport glutathione-disulfide reductase (TIGR01421; EC 1.8.1.7; HMM-score: 257.6)
    mycothione reductase (TIGR03452; EC 1.8.1.15; HMM-score: 247.1)
    thioredoxin and glutathione reductase (TIGR01438; EC 1.6.4.-; HMM-score: 213.5)
    trypanothione-disulfide reductase (TIGR01423; EC 1.8.1.12; HMM-score: 161.1)
    Cellular processes Cellular processes Detoxification CoA-disulfide reductase (TIGR03385; EC 1.8.1.14; HMM-score: 115.3)
    Metabolism Energy metabolism Electron transport thioredoxin-disulfide reductase (TIGR01292; EC 1.8.1.9; HMM-score: 64.6)
    Metabolism Central intermediary metabolism Nitrogen metabolism nitrite reductase [NAD(P)H], large subunit (TIGR02374; EC 1.7.1.4; HMM-score: 56.6)
    Metabolism Amino acid biosynthesis Glutamate family glutamate synthase (NADPH), homotetrameric (TIGR01316; EC 1.4.1.13; HMM-score: 56)
    Cellular processes Cellular processes Detoxification alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 51.3)
    Cellular processes Cellular processes Adaptations to atypical conditions alkyl hydroperoxide reductase subunit F (TIGR03140; EC 1.8.1.-; HMM-score: 51.3)
    Unknown function Enzymes of unknown specificity putative bacillithiol system oxidoreductase, YpdA family (TIGR04018; EC 1.8.-.-; HMM-score: 48.8)
    mycofactocin system FadH/OYE family oxidoreductase 2 (TIGR03997; EC 1.-.-.-; HMM-score: 42.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase family (TIGR02032; EC 1.3.1.-; HMM-score: 41.7)
    glutamate synthase, NADH/NADPH, small subunit (TIGR01317; EC 1.4.1.-; HMM-score: 38.3)
    putative selenate reductase, YgfK subunit (TIGR03315; HMM-score: 38.1)
    pyridine nucleotide-disulfide oxidoreductase family protein (TIGR03169; HMM-score: 37.9)
    putative alkyl hydroperoxide reductase F subunit (TIGR03143; EC 1.6.4.-; HMM-score: 34.7)
    glutamate synthase, small subunit (TIGR01318; HMM-score: 32.3)
    Unknown function Enzymes of unknown specificity flavoprotein, HI0933 family (TIGR00275; HMM-score: 27.8)
    mycofactocin system FadH/OYE family oxidoreductase 1 (TIGR03996; EC 1.-.-.-; HMM-score: 21.6)
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides UDP-galactopyranose mutase (TIGR00031; EC 5.4.99.9; HMM-score: 20.5)
    Metabolism Energy metabolism Amino acids and amines sarcosine oxidase, alpha subunit family (TIGR01372; HMM-score: 19)
    Metabolism Energy metabolism Anaerobic glycerol-3-phosphate dehydrogenase, anaerobic, B subunit (TIGR03378; EC 1.1.5.3; HMM-score: 17.2)
    nucleotide sugar dehydrogenase (TIGR03026; HMM-score: 16.3)
    lycopene cyclase family protein (TIGR01790; HMM-score: 15.9)
    FAD dependent oxidoreductase TIGR03364 (TIGR03364; HMM-score: 15.7)
    squalene-associated FAD-dependent desaturase (TIGR03467; HMM-score: 15.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine thiazole biosynthesis enzyme (TIGR00292; HMM-score: 15)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other phytoene desaturase (TIGR02734; EC 1.14.99.-; HMM-score: 14.7)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA uridine 5-carboxymethylaminomethyl modification enzyme GidA (TIGR00136; HMM-score: 13.4)
    Metabolism Energy metabolism Amino acids and amines alanine dehydrogenase (TIGR00518; EC 1.4.1.1; HMM-score: 12.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone ubiquinone biosynthesis hydroxylase, UbiH/UbiF/VisC/COQ6 family (TIGR01988; EC 1.14.13.-; HMM-score: 11.2)
    Metabolism Energy metabolism Other 4-hydroxybenzoate 3-monooxygenase (TIGR02360; EC 1.14.13.2; HMM-score: 11.2)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Chlorophyll and bacteriochlorphyll geranylgeranyl reductase (TIGR02023; EC 1.3.1.-; HMM-score: 11)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other carotene isomerase (TIGR02730; EC 5.-.-.-; HMM-score: 10.4)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Menaquinone and ubiquinone 2-polyprenyl-6-methoxyphenol 4-hydroxylase (TIGR01984; EC 1.14.13.-; HMM-score: 8.5)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Thiamine glycine oxidase ThiO (TIGR02352; EC 1.4.3.19; HMM-score: 8)
    Metabolism Biosynthesis of cofactors, prosthetic groups, and carriers Other C-3',4' desaturase CrtD (TIGR02733; EC 1.3.99.-; HMM-score: 7.6)
    Metabolism Energy metabolism Electron transport flavocytochrome c (TIGR01813; HMM-score: 6.5)
    Genetic information processing Protein synthesis tRNA and rRNA base modification tRNA U-34 5-methylaminomethyl-2-thiouridine biosynthesis protein MnmC, C-terminal domain (TIGR03197; HMM-score: 4.7)
  • TheSEED: see SA0946
  • PFAM:
    NADP_Rossmann (CL0063) Pyr_redox_2; Pyridine nucleotide-disulphide oxidoreductase (PF07992; HMM-score: 244.3)
    and 19 more
    Reductase_C (CL0608) Pyr_redox_dim; Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain (PF02852; HMM-score: 118.2)
    NADP_Rossmann (CL0063) Pyr_redox; Pyridine nucleotide-disulphide oxidoreductase (PF00070; HMM-score: 75)
    Pyr_redox_3; Pyridine nucleotide-disulphide oxidoreductase (PF13738; HMM-score: 47.3)
    GIDA; Glucose inhibited division protein A (PF01134; HMM-score: 39.4)
    FAD_oxidored; FAD dependent oxidoreductase (PF12831; HMM-score: 29.9)
    NAD_binding_8; NAD(P)-binding Rossmann-like domain (PF13450; HMM-score: 28.7)
    FAD_binding_2; FAD binding domain (PF00890; HMM-score: 28.3)
    HI0933_like; HI0933-like protein (PF03486; HMM-score: 26.9)
    DAO; FAD dependent oxidoreductase (PF01266; HMM-score: 20.8)
    FAD_binding_3; FAD binding domain (PF01494; HMM-score: 20.7)
    3HCDH_N; 3-hydroxyacyl-CoA dehydrogenase, NAD binding domain (PF02737; HMM-score: 18.7)
    NAD_binding_9; FAD-NAD(P)-binding (PF13454; HMM-score: 17.2)
    AlaDh_PNT_C; Alanine dehydrogenase/PNT, C-terminal domain (PF01262; HMM-score: 15.6)
    UDPG_MGDP_dh_N; UDP-glucose/GDP-mannose dehydrogenase family, NAD binding domain (PF03721; HMM-score: 15)
    NAD_binding_7; Putative NAD(P)-binding (PF13241; HMM-score: 14.5)
    Thi4; Thi4 family (PF01946; HMM-score: 13.4)
    no clan defined DUF4150; Domain of unknown function (DUF4150) (PF13665; HMM-score: 12.3)
    NADP_Rossmann (CL0063) Lycopene_cycl; Lycopene cyclase protein (PF05834; HMM-score: 11.3)
    XdhC_C; XdhC Rossmann domain (PF13478; HMM-score: 10.7)

Structure, modifications & cofactors[edit | edit source]

  • domains:
  • modifications:
  • cofactors: FAD
  • effectors:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic
    • Cytoplasmic Score: 9.97
    • Cytoplasmic Membrane Score: 0
    • Cellwall Score: 0.01
    • Extracellular Score: 0.02
    • Internal Helices: 0
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.021819
    • TAT(Tat/SPI): 0.002475
    • LIPO(Sec/SPII): 0.001894
  • predicted transmembrane helices (TMHMM): 0

Accession numbers[edit | edit source]

Protein sequence[edit | edit source]

  • MVVGDFPIETDTIVIGAGPGGYVAAIRAAQLGQKVTIVEKGNLGGVCLNVGCIPSKALLHASHRFVEAQHSENLGVIAESVSLNFQKVQEFKSSVVNKLTGGVEGLLKGNKVNIVKGEAYFVDNNSLRVMDEKSAQTYNFKNAIIATGSRPIEIPNFKFGKRVIDSTGALNLQEVPGKLVVVGGGYIGSELGTAFANFGSEVTILEGAKDILGGFEKQMTQPVKKGMKEKGVEIVTEAMAKSAEETDNGVKVTYEAKGEEKTIEADYVLVTVGRRPNTDELGLEELGVKFADRGLLEVDKQSRTSISNIYAIGDIVPGLPLAHKASYEAKVAAEAIDGQAAEVDYIGMPAVCFTEPELATVGYSEAQAKEEGLAIKASKFPYAANGRALSLDDTNGFVKLITLKEDDTLIGAQVVGTGASDIISELGLAIEAGMNAEDIALTIHAHPTLGEMTMEAAEKAIGYPIHTM

Experimental data[edit | edit source]

  • experimentally validated: data available for COL, NCTC8325
  • protein localization: data available for COL
  • quantitative data / protein copy number per cell: data available for COL
  • interaction partners:
    SA_RS11130(deoA)pyrimidine-nucleoside phosphorylase  [2] (data from MRSA252)
    SA_RS00310aminoglycoside O-nucleotidyltransferase ANT(4')-Ia  [2] (data from MRSA252)
    SA_RS00690immunoglobulin G-binding protein A  [2] (data from MRSA252)
    SA_RS01275formate acetyltransferase  [2] (data from MRSA252)
    SA_RS0201530S ribosomal protein S6  [2] (data from MRSA252)
    SA_RS02095alkyl hydroperoxide reductase subunit C  [2] (data from MRSA252)
    SA_RS02130hypothetical protein  [2] (data from MRSA252)
    SA_RS02145IMP dehydrogenase  [2] (data from MRSA252)
    SA_RS02405methionine ABC transporter substrate-binding protein  [2] (data from MRSA252)
    SA_RS02490YbaB/EbfC family nucleoid-associated protein  [2] (data from MRSA252)
    SA_RS0265050S ribosomal protein L25/general stress protein Ctc  [2] (data from MRSA252)
    SA_RS02710cysteine synthase  [2] (data from MRSA252)
    SA_RS02810pyridoxal 5'-phosphate synthase lyase subunit PdxS  [2] (data from MRSA252)
    SA_RS0290550S ribosomal protein L11  [2] (data from MRSA252)
    SA_RS0291050S ribosomal protein L1  [2] (data from MRSA252)
    SA_RS0291550S ribosomal protein L10  [2] (data from MRSA252)
    SA_RS0295030S ribosomal protein S7  [2] (data from MRSA252)
    SA_RS02955elongation factor G  [2] (data from MRSA252)
    SA_RS02960elongation factor Tu  [2] (data from MRSA252)
    SA_RS03155phosphate acetyltransferase  [2] (data from MRSA252)
    SA_RS03250zinc-dependent alcohol dehydrogenase  [2] (data from MRSA252)
    SA_RS03380metal ABC transporter substrate-binding protein  [2] (data from MRSA252)
    SA_RS04020ribosomal subunit interface protein  [2] (data from MRSA252)
    SA_RS04140aldehyde dehydrogenase  [2] (data from MRSA252)
    SA_RS04145phosphoglycerate kinase  [2] (data from MRSA252)
    SA_RS04150triose-phosphate isomerase  [2] (data from MRSA252)
    SA_RS041552,3-bisphosphoglycerate-independent phosphoglycerate mutase  [2] (data from MRSA252)
    SA_RS04160enolase  [2] (data from MRSA252)
    SA_RS04320thiol reductase thioredoxin  [2] (data from MRSA252)
    SA_RS04575NADH dehydrogenase  [2] (data from MRSA252)
    SA_RS04660NAD-specific glutamate dehydrogenase  [2] (data from MRSA252)
    SA_RS04680glucose-6-phosphate isomerase  [2] (data from MRSA252)
    SA_RS04710hypothetical protein  [2] (data from MRSA252)
    SA_RS04935hypothetical protein  [2] (data from MRSA252)
    SA_RS05190bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase  [2] (data from MRSA252)
    SA_RS05295phosphocarrier protein HPr  [2] (data from MRSA252)
    SA_RS05300phosphoenolpyruvate--protein phosphotransferase  [2] (data from MRSA252)
    SA_RS05350pyruvate dehydrogenase E1 component subunit alpha  [2] (data from MRSA252)
    SA_RS05355pyruvate dehydrogenase E1 component subunit beta  [2] (data from MRSA252)
    SA_RS05360dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex  [2] (data from MRSA252)
    SA_RS05860cell division protein FtsZ  [2] (data from MRSA252)
    SA_RS0612530S ribosomal protein S16  [2] (data from MRSA252)
    SA_RS0614050S ribosomal protein L19  [2] (data from MRSA252)
    SA_RS06165succinyl-CoA ligase subunit beta  [2] (data from MRSA252)
    SA_RS0622530S ribosomal protein S2  [2] (data from MRSA252)
    SA_RS06235elongation factor Ts  [2] (data from MRSA252)
    SA_RS06295translation initiation factor IF-2  [2] (data from MRSA252)
    SA_RS06490glutamine synthetase  [2] (data from MRSA252)
    SA_RS06690transketolase  [2] (data from MRSA252)
    SA_RS07005cold-shock protein CspA  [2] (data from MRSA252)
    SA_RS07060dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex  [2] (data from MRSA252)
    SA_RS070652-oxoglutarate dehydrogenase E1 component  [2] (data from MRSA252)
    SA_RS07385DNA-binding protein HU  [2] (data from MRSA252)
    SA_RS07605phosphogluconate dehydrogenase (NADP(+)-dependent, decarboxylating)  [2] (data from MRSA252)
    SA_RS07955molecular chaperone DnaK  [2] (data from MRSA252)
    SA_RS0828550S ribosomal protein L27  [2] (data from MRSA252)
    SA_RS0829550S ribosomal protein L21  [2] (data from MRSA252)
    SA_RS08435trigger factor  [2] (data from MRSA252)
    SA_RS0846050S ribosomal protein L20  [2] (data from MRSA252)
    SA_RS0846550S ribosomal protein L35  [2] (data from MRSA252)
    SA_RS08480threonine--tRNA ligase  [2] (data from MRSA252)
    SA_RS08545isocitrate dehydrogenase (NADP(+))  [2] (data from MRSA252)
    SA_RS08560pyruvate kinase  [2] (data from MRSA252)
    SA_RS08625universal stress protein UspA  [2] (data from MRSA252)
    SA_RS08630acetate kinase  [2] (data from MRSA252)
    SA_RS0867530S ribosomal protein S4  [2] (data from MRSA252)
    SA_RS08760formate--tetrahydrofolate ligase  [2] (data from MRSA252)
    SA_RS08860D-alanine aminotransferase  [2] (data from MRSA252)
    SA_RS09005transaldolase  [2] (data from MRSA252)
    SA_RS09810non-heme ferritin  [2] (data from MRSA252)
    SA_RS09850aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B  [2] (data from MRSA252)
    SA_RS09960manganese-dependent inorganic pyrophosphatase  [2] (data from MRSA252)
    SA_RS10540co-chaperone GroES  [2] (data from MRSA252)
    SA_RS10760anti-sigma B factor antagonist  [2] (data from MRSA252)
    SA_RS11010uracil phosphoribosyltransferase  [2] (data from MRSA252)
    SA_RS1105050S ribosomal protein L31 type B  [2] (data from MRSA252)
    SA_RS11090DNA-directed RNA polymerase subunit delta  [2] (data from MRSA252)
    SA_RS11150DNA starvation/stationary phase protection protein  [2] (data from MRSA252)
    SA_RS11245glutamine--fructose-6-phosphate aminotransferase  [2] (data from MRSA252)
    SA_RS1160030S ribosomal protein S9  [2] (data from MRSA252)
    SA_RS1160550S ribosomal protein L13  [2] (data from MRSA252)
    SA_RS1163050S ribosomal protein L17  [2] (data from MRSA252)
    SA_RS11635DNA-directed RNA polymerase subunit alpha  [2] (data from MRSA252)
    SA_RS1164530S ribosomal protein S13  [2] (data from MRSA252)
    SA_RS1167050S ribosomal protein L15  [2] (data from MRSA252)
    SA_RS1167550S ribosomal protein L30  [2] (data from MRSA252)
    SA_RS1168030S ribosomal protein S5  [2] (data from MRSA252)
    SA_RS1169050S ribosomal protein L6  [2] (data from MRSA252)
    SA_RS1169530S ribosomal protein S8  [2] (data from MRSA252)
    SA_RS1170550S ribosomal protein L5  [2] (data from MRSA252)
    SA_RS1172030S ribosomal protein S17  [2] (data from MRSA252)
    SA_RS1173050S ribosomal protein L16  [2] (data from MRSA252)
    SA_RS1173530S ribosomal protein S3  [2] (data from MRSA252)
    SA_RS1174050S ribosomal protein L22  [2] (data from MRSA252)
    SA_RS1174530S ribosomal protein S19  [2] (data from MRSA252)
    SA_RS1175050S ribosomal protein L2  [2] (data from MRSA252)
    SA_RS1175550S ribosomal protein L23  [2] (data from MRSA252)
    SA_RS1176050S ribosomal protein L4  [2] (data from MRSA252)
    SA_RS1176550S ribosomal protein L3  [2] (data from MRSA252)
    SA_RS13420L-glutamate gamma-semialdehyde dehydrogenase  [2] (data from MRSA252)
    SA_RS13705L-lactate dehydrogenase  [2] (data from MRSA252)
    SA_RS13730class I fructose-bisphosphate aldolase  [2] (data from MRSA252)
    SA_RS13735malate:quinone oxidoreductase  [2] (data from MRSA252)
    SA_RS13915ornithine carbamoyltransferase  [2] (data from MRSA252)
    SA_RS13920arginine deiminase  [2] (data from MRSA252)

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Protein stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

  1. R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
    A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
    Mol Microbiol: 2002, 43(6);1387-400
    [PubMed:11952893] [WorldCat.org] [DOI] (P p)
  2. 2.000 2.001 2.002 2.003 2.004 2.005 2.006 2.007 2.008 2.009 2.010 2.011 2.012 2.013 2.014 2.015 2.016 2.017 2.018 2.019 2.020 2.021 2.022 2.023 2.024 2.025 2.026 2.027 2.028 2.029 2.030 2.031 2.032 2.033 2.034 2.035 2.036 2.037 2.038 2.039 2.040 2.041 2.042 2.043 2.044 2.045 2.046 2.047 2.048 2.049 2.050 2.051 2.052 2.053 2.054 2.055 2.056 2.057 2.058 2.059 2.060 2.061 2.062 2.063 2.064 2.065 2.066 2.067 2.068 2.069 2.070 2.071 2.072 2.073 2.074 2.075 2.076 2.077 2.078 2.079 2.080 2.081 2.082 2.083 2.084 2.085 2.086 2.087 2.088 2.089 2.090 2.091 2.092 2.093 2.094 2.095 2.096 2.097 2.098 2.099 2.100 2.101 2.102 2.103 2.104 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
    Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
    J Proteome Res: 2011, 10(3);1139-50
    [PubMed:21166474] [WorldCat.org] [DOI] (I p)

Relevant publications[edit | edit source]