Jump to navigation
Jump to search
(Created page with "<protect> <aureodatabase>NCBI date</aureodatabase> =Summary= * <aureodatabase>organism</aureodatabase> * <aureodatabase>locus</aureodatabase> * <aureodatabase>pan locus</aur...") |
m (Text replacement - "gene Genbank" to "gene RefSeq") |
||
(One intermediate revision by the same user not shown) | |||
Line 1: | Line 1: | ||
__TOC__ | |||
<protect> | <protect> | ||
<aureodatabase> | <aureodatabase>annotation</aureodatabase> | ||
=Summary= | =Summary= | ||
* <aureodatabase>organism</aureodatabase> | *<aureodatabase>organism</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>pan locus</aureodatabase> | *<aureodatabase>pan locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>pan gene symbol</aureodatabase> | *<aureodatabase>pan gene symbol</aureodatabase> | ||
* <aureodatabase>gene synonyms</aureodatabase> | *<aureodatabase>gene synonyms</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
</protect> | </protect> | ||
Line 24: | Line 25: | ||
==General== | ==General== | ||
* <aureodatabase>gene type</aureodatabase> | *<aureodatabase>gene type</aureodatabase> | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>gene symbol</aureodatabase> | *<aureodatabase>gene symbol</aureodatabase> | ||
* <aureodatabase>product</aureodatabase> | *<aureodatabase>product</aureodatabase> | ||
* <aureodatabase>gene replicon</aureodatabase> | *<aureodatabase>gene replicon</aureodatabase> | ||
* <aureodatabase>strand</aureodatabase> | *<aureodatabase>strand</aureodatabase> | ||
* <aureodatabase>gene coordinates</aureodatabase> | *<aureodatabase>gene coordinates</aureodatabase> | ||
* <aureodatabase>gene length</aureodatabase> | *<aureodatabase>gene length</aureodatabase> | ||
* <aureodatabase>essential</aureodatabase> | *<aureodatabase>essential</aureodatabase> | ||
*<aureodatabase>gene comment</aureodatabase> | |||
</protect> | </protect> | ||
Line 38: | Line 40: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>gene | *<aureodatabase>gene location</aureodatabase> | ||
* <aureodatabase>gene | *<aureodatabase>gene BioCyc</aureodatabase> | ||
*<aureodatabase>gene MicrobesOnline</aureodatabase> | |||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Phenotype== | ==Phenotype== | ||
</protect> | </protect> | ||
Share your knowledge and add information here. [<span class="plainlinks">[//aureowiki.med.uni-greifswald.de/index.php?title={{PAGENAMEE}}&veaction=edit§ion=6 edit]</span>] | |||
<protect> | <protect> | ||
==DNA sequence== | ==DNA sequence== | ||
* <aureodatabase>gene sequence</aureodatabase> | *<aureodatabase>gene sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
<aureodatabase>RNA regulated operons</aureodatabase> | |||
</protect> | |||
<protect> | |||
=Protein= | =Protein= | ||
<aureodatabase>protein 3D view</aureodatabase> | <aureodatabase>protein 3D view</aureodatabase> | ||
==General== | ==General== | ||
* <aureodatabase>locus</aureodatabase> | *<aureodatabase>locus</aureodatabase> | ||
* <aureodatabase>protein symbol</aureodatabase> | *<aureodatabase>protein symbol</aureodatabase> | ||
* <aureodatabase>protein description</aureodatabase> | *<aureodatabase>protein description</aureodatabase> | ||
* <aureodatabase>protein length</aureodatabase> | *<aureodatabase>protein length</aureodatabase> | ||
* <aureodatabase>theoretical pI</aureodatabase> | *<aureodatabase>theoretical pI</aureodatabase> | ||
* <aureodatabase>theoretical MW</aureodatabase> | *<aureodatabase>theoretical MW</aureodatabase> | ||
* <aureodatabase>GRAVY</aureodatabase> | *<aureodatabase>GRAVY</aureodatabase> | ||
</protect> | </protect> | ||
Line 71: | Line 77: | ||
==Function== | ==Function== | ||
* <aureodatabase>protein reaction</aureodatabase> | *<aureodatabase>protein reaction</aureodatabase> | ||
* <aureodatabase>protein TIGRFAM</aureodatabase> | *<aureodatabase>protein TIGRFAM</aureodatabase> | ||
* <aureodatabase>protein TheSeed</aureodatabase> | *<aureodatabase>protein TheSeed</aureodatabase> | ||
* <aureodatabase>protein PFAM</aureodatabase> | *<aureodatabase>protein PFAM</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
==Structure, modifications & | ==Structure, modifications & cofactors== | ||
* <aureodatabase>protein domains</aureodatabase> | *<aureodatabase>protein domains</aureodatabase> | ||
* <aureodatabase>protein modifications</aureodatabase> | *<aureodatabase>protein modifications</aureodatabase> | ||
* <aureodatabase>protein cofactors</aureodatabase> | *<aureodatabase>protein cofactors</aureodatabase> | ||
* <aureodatabase>protein effectors</aureodatabase> | *<aureodatabase>protein effectors</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein regulated operons</aureodatabase> | ||
</protect> | </protect> | ||
Line 90: | Line 96: | ||
==Localization== | ==Localization== | ||
* <aureodatabase>protein Psortb</aureodatabase> | *<aureodatabase>protein Psortb</aureodatabase> | ||
* <aureodatabase>protein LocateP</aureodatabase> | *<aureodatabase>protein LocateP</aureodatabase> | ||
* <aureodatabase>protein SignalP</aureodatabase> | *<aureodatabase>protein SignalP</aureodatabase> | ||
* <aureodatabase>protein TMHMM</aureodatabase> | *<aureodatabase>protein TMHMM</aureodatabase> | ||
</protect> | </protect> | ||
Line 99: | Line 105: | ||
==Accession numbers== | ==Accession numbers== | ||
* <aureodatabase>protein GI</aureodatabase> | *<aureodatabase>protein GI</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein RefSeq</aureodatabase> | ||
* <aureodatabase>protein | *<aureodatabase>protein UniProt</aureodatabase> | ||
</protect> | </protect> | ||
Line 108: | Line 113: | ||
==Protein sequence== | ==Protein sequence== | ||
* <aureodatabase>protein sequence</aureodatabase> | *<aureodatabase>protein sequence</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Experimental data== | ||
* <aureodatabase>protein validated peptides</aureodatabase> | *<aureodatabase>protein validated peptides</aureodatabase> | ||
*<aureodatabase>protein validated localization</aureodatabase> | |||
*<aureodatabase>protein validated quantitative data</aureodatabase> | |||
*<aureodatabase>protein partners</aureodatabase> | |||
</protect> | </protect> | ||
Line 125: | Line 133: | ||
==Operon== | ==Operon== | ||
* <aureodatabase>operons</aureodatabase> | *<aureodatabase>operons</aureodatabase> | ||
</protect> | </protect> | ||
Line 131: | Line 139: | ||
==Regulation== | ==Regulation== | ||
*<aureodatabase>regulators</aureodatabase> | |||
* <aureodatabase>regulators</aureodatabase> | |||
</protect> | </protect> | ||
Line 138: | Line 145: | ||
==Transcription pattern== | ==Transcription pattern== | ||
* <aureodatabase>expression browser</aureodatabase> | *<aureodatabase>expression browser</aureodatabase> | ||
</protect> | </protect> | ||
Line 144: | Line 151: | ||
==Protein synthesis (provided by Aureolib)== | ==Protein synthesis (provided by Aureolib)== | ||
* <aureodatabase>protein synthesis Aureolib</aureodatabase> | *<aureodatabase>protein synthesis Aureolib</aureodatabase> | ||
</protect> | </protect> | ||
<protect> | <protect> | ||
== | ==Protein stability== | ||
* <aureodatabase>protein half-life</aureodatabase> | *<aureodatabase>protein half-life</aureodatabase> | ||
</protect> | </protect> | ||
Latest revision as of 01:01, 11 March 2016
NCBI: 02-MAR-2017
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus N315
- locus tag: SA_RS02005 [old locus tag: SA0351 ]
- pan locus tag?: SAUPAN001909000
- symbol: SA_RS02005
- pan gene symbol?: ychF
- synonym:
- product: GTP-binding protein YchF
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
⊟Accession numbers[edit | edit source]
⊟Phenotype[edit | edit source]
Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61
121
181
241
301
361
421
481
541
601
661
721
781
841
901
961
1021
1081ATGGCTTTAACAGCAGGTATCGTTGGCTTACCAAACGTTGGTAAATCAACATTATTTAAT
GCAATTACAAAGGCGGGTGCCTTGGCAGCAAACTATCCGTTCGCAACTATAGACCCAAAT
GTGGGTATTGTAGAAGTGCCAGATGCAAGACTACTTAAATTAGAAGAAATGGTTCAACCT
AAAAAAACATTACCTACTACATTTGAATTTACAGATATTGCCGGAATTGTTAAAGGTGCT
TCTAAAGGTGAAGGTTTAGGTAATAAATTCTTATCACATATTAGAGAAGTAGATGCAATT
TGTCAGGTTGTTCGTGCTTTTGACGATGATAATGTAACACATGTAGCTGGTCGAGTTGAT
CCAATTGATGACATCGAAGTTATCAATATGGAATTAGTACTTGCAGACTTAGAATCAGTT
GAAAAACGCTTACCTAGAATTGAAAAATTGGCACGTCAAAAAGATAAGACTGCTGAAATG
GAAGTGCGTATTTTAACAACTATTAAAGAAGCTTTAGAAAATGGTAAACCCGCTCGTAGT
ATTGACTTTAATGAAGAAGACCAAAAATGGGTGAATCAAGCGCAATTACTGACTTCTAAA
AAAATGCTTTATATCGCTAATGTTGGTGAAGATGAAATTGGTGATGATGATAATGATAAA
GTAAAAGCGATTCGTGAATATGCAGCGCAAGAAGACTCTGAAGTGATTGTTATTAGTGCA
AAAATTGAAGAAGAAATTGCTACATTAGATGATGAAGATAAAGAAATGTTCTTAGAAGAT
TTAGGTATCGAAGAACCAGGATTAGATCGATTAATTAGAACAACTTATGAATTATTAGGA
TTATCAACATATTTTACTGCTGGTGTGCAAGAAGTACGTGCTTGGACATTTAAACAAGGT
ATGACTGCACCTCAATGTGCTGGTATCATTCATACTGATTTTGAACGTGGATTTATCCGT
GCCGAAGTAACAAGTTATGATGACTATGTACAATATGGCGGCGAAAGTGGCGCTAAAGAA
GCGGGCAGACAACGATTAGAAGGTAAAGAATATATTATGCAAGATGGCGATATCGTTCAT
TTCAGATTTAATGTATAA60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
1080
1098
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SA_RS02005 [old locus tag: SA0351 ]
- symbol: SA_RS02005
- description: GTP-binding protein YchF
- length: 365
- theoretical pI: 4.33991
- theoretical MW: 40594.7
- GRAVY: -0.288767
⊟Function[edit | edit source]
- TIGRFAM: Unknown function General GTP-binding protein YchF (TIGR00092; HMM-score: 516.4)and 11 moreProtein synthesis Other Obg family GTPase CgtA (TIGR02729; HMM-score: 80.9)Unknown function General GTP-binding protein HflX (TIGR03156; HMM-score: 37.8)Unknown function General small GTP-binding protein domain (TIGR00231; HMM-score: 33.3)Protein synthesis Other ribosome-associated GTPase EngA (TIGR03594; HMM-score: 30.9)Transport and binding proteins Cations and iron carrying compounds ferrous iron transport protein B (TIGR00437; HMM-score: 27.9)Protein synthesis Other ribosome biogenesis GTP-binding protein YlqF (TIGR03596; HMM-score: 24.4)Protein synthesis Other GTP-binding protein Era (TIGR00436; HMM-score: 20.9)Protein fate Protein modification and repair [FeFe] hydrogenase H-cluster maturation GTPase HydF (TIGR03918; HMM-score: 19.2)Protein synthesis tRNA and rRNA base modification tRNA modification GTPase TrmE (TIGR00450; EC 3.6.-.-; HMM-score: 14.1)Protein synthesis Other ribosome biogenesis GTP-binding protein YsxC (TIGR03598; HMM-score: 14.1)Protein synthesis Other ribosome biogenesis GTPase YqeH (TIGR03597; HMM-score: 13.5)
- TheSEED: see SA0351
- PFAM: Ubiquitin (CL0072) YchF-GTPase_C; Protein of unknown function (DUF933) (PF06071; HMM-score: 136.6)and 3 moreP-loop_NTPase (CL0023) MMR_HSR1; 50S ribosome-binding GTPase (PF01926; HMM-score: 83.5)FeoB_N; Ferrous iron transport protein B (PF02421; HMM-score: 33.1)Ubiquitin (CL0072) TGS; TGS domain (PF02824; HMM-score: 15.5)
⊟Structure, modifications & cofactors[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
⊟Localization[edit | edit source]
- PSORTb: Cytoplasmic
- Cytoplasmic Score: 7.5
- Cytoplasmic Membrane Score: 1.15
- Cellwall Score: 0.62
- Extracellular Score: 0.73
- Internal Helices: 0
- LocateP:
- SignalP: no predicted signal peptide
- SP(Sec/SPI): 0.140842
- TAT(Tat/SPI): 0.037919
- LIPO(Sec/SPII): 0.009151
- predicted transmembrane helices (TMHMM): 0
⊟Accession numbers[edit | edit source]
⊟Protein sequence[edit | edit source]
- MALTAGIVGLPNVGKSTLFNAITKAGALAANYPFATIDPNVGIVEVPDARLLKLEEMVQPKKTLPTTFEFTDIAGIVKGASKGEGLGNKFLSHIREVDAICQVVRAFDDDNVTHVAGRVDPIDDIEVINMELVLADLESVEKRLPRIEKLARQKDKTAEMEVRILTTIKEALENGKPARSIDFNEEDQKWVNQAQLLTSKKMLYIANVGEDEIGDDDNDKVKAIREYAAQEDSEVIVISAKIEEEIATLDDEDKEMFLEDLGIEEPGLDRLIRTTYELLGLSTYFTAGVQEVRAWTFKQGMTAPQCAGIIHTDFERGFIRAEVTSYDDYVQYGGESGAKEAGRQRLEGKEYIMQDGDIVHFRFNV
⊟Experimental data[edit | edit source]
- experimentally validated: data available for COL, NCTC8325
- protein localization: data available for COL
- quantitative data / protein copy number per cell: data available for COL
- interaction partners:
SA_RS11130 (deoA) pyrimidine-nucleoside phosphorylase [2] (data from MRSA252) SA_RS09855 (gatA) glutamyl-tRNA(Gln) amidotransferase subunit A [2] (data from MRSA252) SA_RS00150 DNA polymerase III subunit beta [2] (data from MRSA252) SA_RS00185 serine--tRNA ligase [2] (data from MRSA252) SA_RS00310 aminoglycoside O-nucleotidyltransferase ANT(4')-Ia [2] (data from MRSA252) SA_RS00690 immunoglobulin G-binding protein A [2] (data from MRSA252) SA_RS01275 formate acetyltransferase [2] (data from MRSA252) SA_RS01445 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase [2] (data from MRSA252) SA_RS01710 5'-nucleotidase, lipoprotein e(P4) family [2] (data from MRSA252) SA_RS02025 30S ribosomal protein S18 [2] (data from MRSA252) SA_RS02095 alkyl hydroperoxide reductase subunit C [2] (data from MRSA252) SA_RS02145 IMP dehydrogenase [2] (data from MRSA252) SA_RS02640 ribose-phosphate pyrophosphokinase [2] (data from MRSA252) SA_RS02695 hypoxanthine-guanine phosphoribosyltransferase [2] (data from MRSA252) SA_RS02710 cysteine synthase [2] (data from MRSA252) SA_RS02735 lysine--tRNA ligase [2] (data from MRSA252) SA_RS02810 pyridoxal 5'-phosphate synthase lyase subunit PdxS [2] (data from MRSA252) SA_RS02905 50S ribosomal protein L11 [2] (data from MRSA252) SA_RS02910 50S ribosomal protein L1 [2] (data from MRSA252) SA_RS02915 50S ribosomal protein L10 [2] (data from MRSA252) SA_RS02955 elongation factor G [2] (data from MRSA252) SA_RS02960 elongation factor Tu [2] (data from MRSA252) SA_RS03115 hydroxymethylpyrimidine/phosphomethylpyrimidine kinase [2] (data from MRSA252) SA_RS03155 phosphate acetyltransferase [2] (data from MRSA252) SA_RS03380 metal ABC transporter substrate-binding protein [2] (data from MRSA252) SA_RS03645 hypothetical protein [2] (data from MRSA252) SA_RS04020 ribosomal subunit interface protein [2] (data from MRSA252) SA_RS04140 aldehyde dehydrogenase [2] (data from MRSA252) SA_RS04150 triose-phosphate isomerase [2] (data from MRSA252) SA_RS04155 2,3-bisphosphoglycerate-independent phosphoglycerate mutase [2] (data from MRSA252) SA_RS04160 enolase [2] (data from MRSA252) SA_RS04325 arsenate reductase [2] (data from MRSA252) SA_RS04420 ABC transporter ATP-binding protein [2] (data from MRSA252) SA_RS04575 NADH dehydrogenase [2] (data from MRSA252) SA_RS04710 hypothetical protein [2] (data from MRSA252) SA_RS04915 enoyl-ACP reductase [2] (data from MRSA252) SA_RS05295 phosphocarrier protein HPr [2] (data from MRSA252) SA_RS05300 phosphoenolpyruvate--protein phosphotransferase [2] (data from MRSA252) SA_RS05355 pyruvate dehydrogenase E1 component subunit beta [2] (data from MRSA252) SA_RS05860 cell division protein FtsZ [2] (data from MRSA252) SA_RS06085 beta-ketoacyl-ACP reductase [2] (data from MRSA252) SA_RS06140 50S ribosomal protein L19 [2] (data from MRSA252) SA_RS06165 succinyl-CoA ligase subunit beta [2] (data from MRSA252) SA_RS06225 30S ribosomal protein S2 [2] (data from MRSA252) SA_RS06315 30S ribosomal protein S15 [2] (data from MRSA252) SA_RS06490 glutamine synthetase [2] (data from MRSA252) SA_RS06690 transketolase [2] (data from MRSA252) SA_RS07060 dihydrolipoyllysine-residue succinyltransferase component of 2-oxoglutarate dehydrogenase complex [2] (data from MRSA252) SA_RS07205 serine/threonine dehydratase [2] (data from MRSA252) SA_RS07385 DNA-binding protein HU [2] (data from MRSA252) SA_RS08285 50S ribosomal protein L27 [2] (data from MRSA252) SA_RS08435 trigger factor [2] (data from MRSA252) SA_RS08505 aldehyde dehydrogenase [2] (data from MRSA252) SA_RS08545 isocitrate dehydrogenase (NADP(+)) [2] (data from MRSA252) SA_RS08560 pyruvate kinase [2] (data from MRSA252) SA_RS08600 universal stress protein [2] (data from MRSA252) SA_RS08625 universal stress protein UspA [2] (data from MRSA252) SA_RS08630 acetate kinase [2] (data from MRSA252) SA_RS09810 non-heme ferritin [2] (data from MRSA252) SA_RS09850 aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase subunit B [2] (data from MRSA252) SA_RS10855 D-alanine--D-alanine ligase [2] (data from MRSA252) SA_RS10945 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [2] (data from MRSA252) SA_RS11010 uracil phosphoribosyltransferase [2] (data from MRSA252) SA_RS11070 UDP-N-acetylglucosamine 1-carboxyvinyltransferase [2] (data from MRSA252) SA_RS11430 Asp23/Gls24 family envelope stress response protein [2] (data from MRSA252) SA_RS11600 30S ribosomal protein S9 [2] (data from MRSA252) SA_RS11605 50S ribosomal protein L13 [2] (data from MRSA252) SA_RS11640 30S ribosomal protein S11 [2] (data from MRSA252) SA_RS11645 30S ribosomal protein S13 [2] (data from MRSA252) SA_RS11675 50S ribosomal protein L30 [2] (data from MRSA252) SA_RS11680 30S ribosomal protein S5 [2] (data from MRSA252) SA_RS11690 50S ribosomal protein L6 [2] (data from MRSA252) SA_RS11695 30S ribosomal protein S8 [2] (data from MRSA252) SA_RS11705 50S ribosomal protein L5 [2] (data from MRSA252) SA_RS11735 30S ribosomal protein S3 [2] (data from MRSA252) SA_RS11740 50S ribosomal protein L22 [2] (data from MRSA252) SA_RS11745 30S ribosomal protein S19 [2] (data from MRSA252) SA_RS11750 50S ribosomal protein L2 [2] (data from MRSA252) SA_RS11755 50S ribosomal protein L23 [2] (data from MRSA252) SA_RS11760 50S ribosomal protein L4 [2] (data from MRSA252) SA_RS11770 30S ribosomal protein S10 [2] (data from MRSA252) SA_RS13340 pyruvate oxidase [2] (data from MRSA252) SA_RS13375 hydroxymethylglutaryl-CoA synthase [2] (data from MRSA252) SA_RS13420 L-glutamate gamma-semialdehyde dehydrogenase [2] (data from MRSA252) SA_RS13730 class I fructose-bisphosphate aldolase [2] (data from MRSA252) SA_RS13735 malate:quinone oxidoreductase [2] (data from MRSA252) SA_RS13920 arginine deiminase [2] (data from MRSA252)
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
⊟Regulation[edit | edit source]
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: data available for NCTC8325
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
⊟Protein stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.
⊟Literature[edit | edit source]
⊟References[edit | edit source]
- ↑ R Allyn Forsyth, Robert J Haselbeck, Kari L Ohlsen, Robert T Yamamoto, Howard Xu, John D Trawick, Daniel Wall, Liangsu Wang, Vickie Brown-Driver, Jamie M Froelich, Kedar G C, Paula King, Melissa McCarthy, Cheryl Malone, Brian Misiner, David Robbins, Zehui Tan, Zhan-yang Zhu Zy, Grant Carr, Deborah A Mosca, Carlos Zamudio, J Gordon Foulkes, Judith W Zyskind
A genome-wide strategy for the identification of essential genes in Staphylococcus aureus.
Mol Microbiol: 2002, 43(6);1387-400
[PubMed:11952893] [WorldCat.org] [DOI] (P p) - ↑ 2.00 2.01 2.02 2.03 2.04 2.05 2.06 2.07 2.08 2.09 2.10 2.11 2.12 2.13 2.14 2.15 2.16 2.17 2.18 2.19 2.20 2.21 2.22 2.23 2.24 2.25 2.26 2.27 2.28 2.29 2.30 2.31 2.32 2.33 2.34 2.35 2.36 2.37 2.38 2.39 2.40 2.41 2.42 2.43 2.44 2.45 2.46 2.47 2.48 2.49 2.50 2.51 2.52 2.53 2.54 2.55 2.56 2.57 2.58 2.59 2.60 2.61 2.62 2.63 2.64 2.65 2.66 2.67 2.68 2.69 2.70 2.71 2.72 2.73 2.74 2.75 2.76 2.77 2.78 2.79 2.80 2.81 2.82 2.83 2.84 2.85 2.86 Artem Cherkasov, Michael Hsing, Roya Zoraghi, Leonard J Foster, Raymond H See, Nikolay Stoynov, Jihong Jiang, Sukhbir Kaur, Tian Lian, Linda Jackson, Huansheng Gong, Rick Swayze, Emily Amandoron, Farhad Hormozdiari, Phuong Dao, Cenk Sahinalp, Osvaldo Santos-Filho, Peter Axerio-Cilies, Kendall Byler, William R McMaster, Robert C Brunham, B Brett Finlay, Neil E Reiner
Mapping the protein interaction network in methicillin-resistant Staphylococcus aureus.
J Proteome Res: 2011, 10(3);1139-50
[PubMed:21166474] [WorldCat.org] [DOI] (I p)