From AureoWiki
Revision as of 19:31, 12 January 2016 by Robot (talk | contribs) (Created page with "<protect> <aureodatabase>NCBI date</aureodatabase> =Summary= * <aureodatabase>organism</aureodatabase> * <aureodatabase>locus</aureodatabase> * <aureodatabase>pan locus</aur...")
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search
COLN315NCTC8325NewmanUSA300_FPR375704-0298108BA0217611819-97685071193ECT-R 2ED133ED98HO 5096 0412JH1JH9JKD6008JKD6159LGA251M013MRSA252MSHR1132MSSA476MW2Mu3Mu50RF122ST398T0131TCH60TW20USA300_TCH1516VC40

Genome View[edit | edit source]

Gene[edit | edit source]

General[edit | edit source]

  • type: CDS
  • locus tag: SAUSA300_RS14460
  • symbol: SAUSA300_RS14460
  • product: poly-beta-1,6-N-acetyl-D-glucosamine synthesis protein IcaD
  • replicon: chromosome
  • strand: +
  • coordinates: 2827813..2828118
  • length: 306
  • essential: unknown

Accession numbers[edit | edit source]

  • Gene ID:
  • gene Genbank : _

Phenotype[edit | edit source]

  • Share your knowledge and add information here. [edit]

DNA sequence[edit | edit source]

  • 1
    61
    121
    181
    241
    301
    ATGGTCAAGCCCAGACAGAGGGAATACCCAACGCTAAAATCATCGCTAAATATTGTAAGA
    GAAACAGCACTTATCGCTATATCTTGTGTCTTTTGGATATATTGTTTAGTTGTTCTACTC
    GTTTATATTGGTACTATATTTGAAATTCATGACGAAAGTATCAATACAATACGTGTTGCT
    TTAAACATTGAAAATACTGAAATTTTAGATATATTTGAAACTATGGGCATTTTCGCGATT
    ATCATTTTTGTATTTTTTACAATTAGCATATTGATTCAAAAATGGCAGAGAGGAAGAGAA
    TCGTGA
    60
    120
    180
    240
    300
    306

Protein[edit | edit source]

General[edit | edit source]

  • locus tag: SAUSA300_RS14460
  • symbol: SAUSA300_RS14460
  • description: poly-beta-1,6-N-acetyl-D-glucosamine synthesis protein IcaD
  • length: 101
  • theoretical pI: 5.82065
  • theoretical MW: 11782.9
  • GRAVY: 0.670297

Function[edit | edit source]

  • TIGRFAM:
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides intracellular adhesion protein D (TIGR03932; HMM-score: 132.7)
    and 2 more
    Cell structure Cell envelope Biosynthesis and degradation of surface polysaccharides and lipopolysaccharides oligosaccharide repeat unit polymerase (TIGR04370; HMM-score: 14.1)
    integral membrane protein (TIGR04561; HMM-score: 5)
  • TheSEED:
  • PFAM:
    APC (CL0062) Spore_permease; Spore germination protein (PF03845; HMM-score: 19.2)
    Aa_trans; Transmembrane amino acid transporter protein (PF01490; HMM-score: 15.8)
    and 3 more
    no clan defined DUF1456; Protein of unknown function (DUF1456) (PF07308; HMM-score: 14.1)
    Peptidase_MA (CL0126) DUF3810; Protein of unknown function (DUF3810) (PF12725; HMM-score: 9.3)
    no clan defined DUF3671; Protein of unknown function (PF12420; HMM-score: 8)

Structure, modifications & interactions[edit | edit source]

  • domains:
  • modifications:
  • cofactors:
  • effectors:
  • interaction partners:

Localization[edit | edit source]

  • PSORTb: Cytoplasmic Membrane
    • Cytoplasmic Score: 0.01
    • Cytoplasmic Membrane Score: 9.99
    • Cellwall Score: 0
    • Extracellular Score: 0
    • Internal Helices: 2
  • LocateP:
  • SignalP: no predicted signal peptide
    • SP(Sec/SPI): 0.000853
    • TAT(Tat/SPI): 0.000208
    • LIPO(Sec/SPII): 0.023432
  • predicted transmembrane helices (TMHMM): 2

Accession numbers[edit | edit source]

  • GI: 446162725 NCBI
  • UniProt:
  • protein Genbank : _
  • RefSeq: WP_000240580 NCBI

Protein sequence[edit | edit source]

  • MVKPRQREYPTLKSSLNIVRETALIAISCVFWIYCLVVLLVYIGTIFEIHDESINTIRVALNIENTEILDIFETMGIFAIIIFVFFTISILIQKWQRGRES

Peptides[edit | edit source]

  • experimentally validated:

Expression & Regulation[edit | edit source]

Operon[edit | edit source]

Regulation[edit | edit source]

  • sigma factors : _
  • regulator:

Transcription pattern[edit | edit source]

Protein synthesis (provided by Aureolib)[edit | edit source]

Stability[edit | edit source]

  • half-life: no data available

Biological Material[edit | edit source]

Mutants[edit | edit source]

Expression vector[edit | edit source]

lacZ fusion[edit | edit source]

GFP fusion[edit | edit source]

two-hybrid system[edit | edit source]

FLAG-tag construct[edit | edit source]

Antibody[edit | edit source]

Other Information[edit | edit source]

You are kindly invited to share additional interesting facts.

Literature[edit | edit source]

References[edit | edit source]

Relevant publications[edit | edit source]