Jump to navigation
Jump to search
m (Text replacement - "<protect> =Summary= * <aureodatabase>organism" to "<protect> <aureodatabase>NCBI date</aureodatabase> =Summary= * <aureodatabase>organism") |
m (Text replacement - "* <aureodatabase>protein Genbank</aureodatabase> " to "") |
||
Line 101: | Line 101: | ||
* <aureodatabase>protein GI</aureodatabase> | * <aureodatabase>protein GI</aureodatabase> | ||
* <aureodatabase>protein UniProt</aureodatabase> | * <aureodatabase>protein UniProt</aureodatabase> | ||
* <aureodatabase>protein RefSeq</aureodatabase> | * <aureodatabase>protein RefSeq</aureodatabase> | ||
</protect> | </protect> |
Revision as of 21:07, 10 March 2016
NCBI date : _
⊟Summary[edit | edit source]
- organism: Staphylococcus aureus USA300_FPR3757
- locus tag: SAUSA300_2015 [new locus tag: SAUSA300_RS11085 ]
- pan locus tag?: SAUPAN005317000
- symbol: rrfD
- pan gene symbol?: rrfE
- synonym: rrf
- product: 5S ribosomal RNA
⊟Genome View[edit | edit source]
⊟Gene[edit | edit source]
⊟General[edit | edit source]
- type: rRNA
- locus tag: SAUSA300_2015 [new locus tag: SAUSA300_RS11085 ]
- symbol: rrfD
- product: 5S ribosomal RNA
- replicon: chromosome
- strand: -
- coordinates: 2175811..2175925
- length: 115
- essential: unknown
⊟Accession numbers[edit | edit source]
- Gene ID: 3915348 NCBI
- gene Genbank : _
⊟Phenotype[edit | edit source]
- Share your knowledge and add information here. [edit]
⊟DNA sequence[edit | edit source]
- 1
61TCTGGTGACTATAGCAAGGAGGTCACACCTGTTCCCATGCCGAACACAGAAGTTAAGCTC
CTTAGCGTCGATGGTAGTCGAACTTACGTTCCGCTAGAGTAGAACGTTGCCAGGC60
115
⊟Protein[edit | edit source]
⊟General[edit | edit source]
- locus tag: SAUSA300_2015 [new locus tag: SAUSA300_RS11085 ]
- symbol: RrfD
- description: 5S ribosomal RNA
- length:
- theoretical pI:
- theoretical MW:
- GRAVY:
⊟Function[edit | edit source]
- TIGRFAM:
- TheSEED:
- PFAM:
⊟Structure, modifications & interactions[edit | edit source]
- domains:
- modifications:
- cofactors:
- effectors:
- interaction partners:
⊟Localization[edit | edit source]
- PSORTb:
- LocateP:
- SignalP:
- predicted transmembrane helices (TMHMM):
⊟Accession numbers[edit | edit source]
- GI:
- UniProt:
- RefSeq:
⊟Protein sequence[edit | edit source]
⊟Peptides[edit | edit source]
- experimentally validated:
⊟Expression & Regulation[edit | edit source]
⊟Operon[edit | edit source]
- MicrobesOnline: no polycistronic organisation predicted
⊟Regulation[edit | edit source]
- sigma factors : _
- regulator:
⊟Transcription pattern[edit | edit source]
- S.aureus Expression Data Browser: no data available
⊟Protein synthesis (provided by Aureolib)[edit | edit source]
- Aureolib: no data available
⊟Stability[edit | edit source]
- half-life: no data available
⊟Biological Material[edit | edit source]
⊟Mutants[edit | edit source]
⊟Expression vector[edit | edit source]
⊟lacZ fusion[edit | edit source]
⊟GFP fusion[edit | edit source]
⊟two-hybrid system[edit | edit source]
⊟FLAG-tag construct[edit | edit source]
⊟Antibody[edit | edit source]
⊟Other Information[edit | edit source]
You are kindly invited to share additional interesting facts.